NIA Mouse Gene Index (mm92)

Exon structure for U021135

chr1 -

Exon1 14908943 - 14908806
	GCGCCAGCCGGCGTCCAGGTGGAGTCAATGAAGCGCGGCTTGAGGAGGATTCTGCTCCCGGAGGAAAGGAAGGAGGTCCAGGGCGTTGTCTATCGCGGCG
	TCGGGGAAGACATGGACTGCTCCAAGGAATCCTTTAAG
Exon2 14902600 - 14902441
	GTGGACATTGAAGGAGATATGTGTAGATTAGAAGACTTCATCAAGAACCGAAGAAAACTAAGCAAATATGAGGATGAAAATCTCTGTCCTCTGCATCACG
	CAGCAGCAGAAGGTCAAGTTGAACTGATGGAACTGATCATCAATGGTTCTTCGTGTGAAG
Exon3 14900986 - 14900811
	TGCTGAATATAATGGATGGTTATGGAAATACCCCACTGCATTGTGCTGCAGAAAAAAATCAAGTTGAAAGTGTAAAGTTTCTTCTCAGCCAAGGAGCAAA
	TCCAAACCTCCGAAATAGAAACATGATGTCACCCCTTCACATAGCTGTGCATGGCATGTACAACGAAGTGATCAAG
Exon4 14896111 - 14896004
	GTGTTGACTGAGCACAAGGCCACTAACATCAATTTAGAAGGAGAGAATGGGAACACGGCTTTGATGTCCACGTGTGCCAAAGACAACAGTGAAGCTTTGC
	AAATTTTG
Exon5 14894642 - 14894534
	TTAGAAAAAGGAGCTAAGCTGTGTAAATCAAATAAGTGGGGAGACTACCCTGTGCACCAGGCAGCATTTTCAGGTGCCAAAAAATGCATGGAATTAATCT
	TAGCATATG
Exon6 14894373 - 14894228
	GTGAAAAGAACGGCTACAGCAGGGAGACTCACATTAATTTTGTGAATCACAAGAAAGCCAGCCCTCTCCACCTAGCAGTTCAAAGCGGAGACTTGGACAT
	GATTAAGATGTGCCTGGACAACGGTGCACACATCGACATGATGGAG
Exon7 14893363 - 14893227
	AATGCCAAATGCATGGCCCTCCATTTTGCTGCAACCCAGGGAGCCACTGACATCGTTAAGCTCATGATCTCATCCTATACCGGAAGTAGTGATATTGTGA
	ATGCAGTTGATGGCAATCAGGAGACCCTGCTTCACAG
Exon8 14891991 - 14891943
	AGCCTCGTTATTTGATCACCATGACCTGGCAGAATACCTAATATCAGTG
Exon9 14890245 - 14890146
	GGAGCAGACATCAACAGCACTGATTCTGAAGGACGCTCTCCACTTATTTTAGCAACAGCTTCTGCATCCTGGAACATTGTGAATTTGCTCCTCTGTAAAG
Exon10 14889528 - 14889428
	GTGCCAAAGTAGACATAAAAGATCATCTTGGACGTAACTTTTTGCATTTGACTGTGCAGCAGCCTTATGGACTAAGAAATTTGCGGCCTGAGTTTATGCA
	G
Exon11 14888506 - 14888337
	ATGCAACACATCAAAGAGCTGGTGATGGATGAAGACAATGACGGATGCACACCTCTCCATTATGCCTGTAGGCAGGGGGTTCCTGTCTCTGTAAATAACC
	TCCTTGGCTTCAATGTGTCCATTCATAGCAAAAGTAAAGATAAGAAGTCGCCCCTGCATTTTGCAGCCAG
Exon12 14888254 - 14888090
	TTATGGGCGCATCAATACATGTCAGAGACTTCTGCAAGACATAAGTGATACGAGGCTTTTGAATGAAGGGGATCTCCATGGGATGACCCCTCTCCACCTG
	GCAGCAAAAAATGGGCATGATAAAGTCGTTCAACTCCTTCTGAAGAAAGGGGCCTTATTTCTCAG
Exon13 14886687 - 14886573
	TGACCACAATGGCTGGACTGCTTTGCATCACGCCTCCATGGGTGGGTACACTCAGACCATGAAGGTCATTCTTGATACTAACTTGAAATGCACAGACCGA
	CTAGATGAAGAAGGG
Exon14 14883430 - 14883264
	AACACAGCACTCCACTTTGCAGCACGGGAAGGCCATGCCAAGGCTGTTGCAATGCTTTTGAGCTACAATGCTGACATCCTCCTGAACAAGAAGCAAGCTT
	CCTTTCTGCATATTGCCCTGCACAATAAGCGCAAGGAAGTGGTTCTCACAACCATCAGAAATAAAAG
Exon15 14881479 - 14881386
	ATGGGATGAGTGTCTTCAAGTTTTCACTCATAATTCTCCAAGCAATCGATGTCCAATCATGGAGATGGTAGAATACCTCCCCGAGTGCATGAAA
Exon16 14880535 - 14880476
	GTTCTTTTAGATTTCTGCATGATACCTTCCACAGAAGACAAGTCCTGTCAAGACTACCAT
Exon17 14879573 - 14879475
	ATTGAGTATAATTTCAAGTATCTCCAATGCCCATTATCCATGACCAAAAAAGTAGCACCTACCCAGGATGTGGTATATGAGCCTCTTACAATCCTCAAT
Exon18 14877746 - 14877676
	GTCATGGTCCAACATAACCGCATAGAACTCCTCAACCACCCTGTGTGTAGGGAGTACTTACTCATGAAATG
Exon19 14877133 - 14876968
	GTGTGCCTATGGATTCAGAGCCCATATGATGAACCTAGGATCTTATTGTCTTGGTCTCATACCCATGACCCTTCTTGTTGTCAAAATACAGCCTGGAATG
	GCCTTCAATTCTACTGGAATAATCAATGGAACTAGTAGTACTCATGAGGAAAGAATAGACACTCTG
Exon20 14875920 - 14875831
	AATTCATTTCCAATAAAAATATGTATGATTCTAGTTTTTTTATCAAGTATATTTGGATATTGCAAAGAAGTGATCCAAATTTTCCAACAG
Exon21 14874360 - 14874191
	AAAAGGAATTACTTCCTGGATTACAACAATGCTCTGGAATGGGTTATCTATACAACTAGTATCATCTTCGTGTTGCCCTTGTTCCTCAACATCCCAGCGT
	ATATGCAGTGGCAATGTGGAGCAATAGCGATATTCTTCTACTGGATGAACTTCCTACTGTATCTTCAAAG
Exon22 14872322 - 14872193
	GTTTGAGAACTGTGGAATTTTCATTGTTATGTTGGAGGTGATTTTTAAAACATTGCTGAGATCGACCGGAGTGTTTATCTTCCTCCTACTGGCTTTTGGC
	CTCAGCTTTTATGTTCTCCTGAATTTCCAA
Exon23 14871860 - 14871678
	GATGCCTTCAGCACCCCATTGCTTTCCTTAATCCAGACATTCAGTATGATGCTAGGAGACATCAATTATCGAGATGCCTTCCTAGAACCATTGTTTAGAA
	ATGAGTTGGCATACCCAGTCCTGACCTTTGGGCAGCTTATTGCCTTCACAATGTTTGTCCCAATTGTTCTCATGAACTTACTG
Exon24 14870348 - 14870280
	ATTGGCTTGGCGGTTGGGGACATTGCTGAGGTCCAGAAGCATGCGTCATTGAAGAGGATTGCTATGCAG
Exon25 14866040 - 14865930
	GTGGAACTTCATACCAACTTAGAAAAAAAGCTGCCACTCTGGTACTTACGCAAAGTGGATCAGAGGTCCACCATCGTGTATCCAAATAGACCCAGGCACG
	GCAGGATGCTA
Exon26 14864542 - 14864445
	CGGTTTTTTCATTACTTTCTTAATATGCAAGAAACACGACAAGAAGTACCAAACATTGACACATGCTTGGAAATGGAAATATTGAAACAGAAATATCG
Exon27 14863809 - 14862725
	GCTGAAGGACCTCACTTCCCTCTTGGAAAAGCAGCATGAGCTCATCAAACTCATCATCCAGAAGATGGAGATCATCTCAGAGACAGAAGATGAAGATAAC
	CATTGCTCTTTCCAAGACAGGTTCAAGAAGGAGAGGCTGGAACAGATGCACAGCAAGTGGAATTTTGTCTTAAACGCAGTTAAGACTAAAACACATTGTT
	CTATTAGCCACCCGGACTTTTAGTTCTGTGTCTTATGGGAGTGGGAGACTGCTTTACATACTTATTTCAGTGAATTTCAGTTTGGAAAAGAGCAAAGAAA
	CAGAAAGTTGACTAACATTGCTGCATGGAGATCCTAGTTCCTGCAACCTCACCCATACATATGCTCATATTTCCTGTCAATTACTATGTATTGAGAAGAT
	CCTTTCTGACATGTTCAATTTGAACATGAAGGATAGTCTCTTTCGAGTGAATAAAAACCAGGGTTGTTGGAATGCATATTATGGAGGATAAGAATTAATG
	TAACTATTAAGGCAGAACACAACTACATAATACAAGATGCATATAATTCCAAGTATTATATTTAATCTCCTACCATGTTAAACCTTCCTGTGTTATAACC
	TGTCTGGGACACTATAATCTCTGTTCCTACTATGATTAGATCATAGTCTCACCCTCCTCGTCCCATCACACATGACATCATTTTGAGCCACATGACAGAA
	GTCCTAGTTAGTAGACTGTGATAAGTATGAATGTTACAATAGAAATGTGTTCCCTTAGTGTTCATCAGTtgtgatggtttaaatgagaaacgttgcccac
	agactcatacatttaaacccttagtcccagttgttgctgctgcttaggggggccacacagccttgcttgctctctcctttctgagtgtggagagaaatgt
	gatcagtaagactcctgctcctgctgccatgctctttattccattatggacttcttctgaaactgcaagcagaaattcactgttccttcctcaaatttct
	tttggtcatggtattatatcatagcaacagaaactaactTATGTACCAATGGTCTTAATAAAGAATAAAGCCTGTACAGTCACTC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+8dbEST_BY010767.1,dbEST_BY011642.1,ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
23+9dbEST_BB644300.1,dbEST_BY010767.1,dbEST_BY011642.1,ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
34+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
45+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
56+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
67+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
78+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
89+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
910+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
1011+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
1112+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
1213+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
1314+7dbEST_DV655555.1,ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
1415+7dbEST_DV655555.1,ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
1516+7dbEST_DV655555.1,ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
1617+7dbEST_DV655555.1,ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
1718+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
1819+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
1920+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
2021+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
2122+6ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
2223+10dbEST_CN673057.1,dbEST_CN673487.1,ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
2324+10dbEST_CN673057.1,dbEST_CN673487.1,ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
2425+10dbEST_CN673057.1,dbEST_CN673487.1,ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
2526+9dbEST_DV653236.1,ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,
2627+7dbEST_DV653236.1,ENSMUST00000041447,REF_NM_177781.4,GB_AK045771.1,GB_BC120563.1,GB_BC131963.1,GB_AY231177.1,