NIA Mouse Gene Index (mm92)

Exon structure for U021179

chr1 -

Exon1a 24107180 - 24106903
	AggggcggggccgcgggccgggACCTGTTGAACGCAGGTAGCGCTCGGCGGCCCGGTTCCCTTGGGACCGACGCGACTGCGCATGCTCGCCGGCGGCTCT
	GGGCCGGGAGCCGAGCGCCGGAGACGAGCCGGCTCTTGGCTTTGCGGTGGTTGCGGGTGCTGCGATGGCGATGTGAGCGGGCCCGGGGCGGGATGGTGCG
	GACCTGGCTAAGGACGCCTACCAGCCGGACGCAGAGCTCCTCCGTCGCACAGGCGCCAGCCGAGGCCGTGCCGGTTGA
Exon1b 24106902 - 24106900
	GAG
Exon2 24105560 - 24105470
	AGGGTTGAAGAACAACTGGATTATGTATTTCATTCTGGAATCTCAAAGCAGCCTGCAAACAATAAGTTCTTCCTTAAGTTATCTATGTCAG
Exon3 24093450 - 24093359
	GGGGCACAATATATTTTTAACAACAAGAATCAGTAACTGGAAATACAAGGTTCATTATTTAATAATGTAAAATGAAGATCTGATCAGCAGAG
Exon4 24092365 - 24092250
	GTGCTGTTACCAGATTTGCCCTCTGGGTATAAATTAAAAATGACTGAAGTTCAAGCAATGGTAGAATTCTCCGTGGAGCTAAACAAGTTCTACAACGTGG
	ATTTATTCCAAAGAGG
Exon5 24074817 - 24074738
	TTTTTACCAAATACGCGCATCGATGAAAATACCAGCAAGAATTCCCCACCGAGTAGAAGCCAGTTTGTTACACGCAACAG
Exon6 24064344 - 24064205
	GCATGACATTAGCCTTTCCAGCTTCCGTTCATGATGCTCTGGTTTGCAGCAAAACATTTCAGATCCTATATAAAAATGAAGAAGTTGTTTTAAATGATGT
	CATGATCTTCAAAGTTAAAATGCTGTTGGATGAAAGAAAG
Exon7 24064113 - 24064043
	ATTGAAGAAACCCTTGAAGAAATCAGTTTTTTGTTATCGTTGGGTCTACATTTCACAGATGGAGACTATTC
Exon8 24062756 - 24062583
	GGCAGATGATCTGAATGCCTTGCAACTAATAAGCAGTCGGACATTGAAGCTGCACTATAGCATCTGTAGAGGCCTTCATCACCATGCGAATGTCATGTTT
	GATTACTTCCACCTGTCTGTGGTGTCCGTTACAGTTCACGCGTCATTGGTTGCACTACACCAGCCGCTAATAAG
Exon9 24060969 - 24060843
	CTTTCCTCGCCCTGTGAAGACCACTTGGTTAAATAGAAATGCGCCAGCACAGAGCAAAGACTCGGCGATTCCGACTCTGGAAAGTGTAGTCTTTGGTATT
	AACTACACAAAACAGTTATCACCAGAT
Exon10 24060175 - 24060022
	GGCTGTAGCTTCCTCATTGCAGAGTCCTTCCTGCACCATGCCTATCATTTTCATTATACACTTTGTGCTACTTTGCTGCTAGCCTTCAAGGGATTGCACA
	GCTACTTCATTACGGTAACAGAAGAGATTCCCTCTTGTCAGAAACTAGACCTGG
Exon11 24056046 - 24055969
	CCAAGGCCAGCATGCAGGTCCTATATGAGCGCCTCCTCAGAAGAACACAGCCAAGAACTCAGAACGACACGTGTCTAG
Exon12 24053246 - 24053197
	AGGAAATGGATGTAGAAGCTCGTCTTACTGAACTGTGTGAAGAAGTTAAG
Exon13 24051108 - 24050953
	AAAGTAGAAAACCCTGATGAACTGGCAGAACTCATCAACATGAACCTTGCACAGCTCTGCTCACTTCTCATGGCTTTATGGGGACAGTTTTTGGAAGCTA
	TAACACTGCATGAAGATTTAAGAGTGCTGTTAGCACAGGAACACCATACTTTGAGG
Exon14 24049863 - 24049788
	agtattggccactggttgcatagagtaccctcagtttggtctattcttcctagtaaatagagtaaaatgacacaat
Exon15 24039575 - 24039502
	GTTCGCAGATTTTCGGAGGCGTTCTTTTGTTTTGAACATCCAAGAGAAGCTGCCATTGCATACCAAGAACTCCA
Exon16 24037735 - 24037581
	TGCTCAGAGTCATCTACAGATGTGCACCGCTATCAAAAATACTTCCTTCTGCAGTTCTCTTCCACCCCTACCTATTGAATGTAGTGAATTAGATGGAGAT
	CTCAATTCATTACCTATAATCTTTGAAGATAGGTATTTAGATTCAGTTATTGAAG
Exon17 24037367 - 24035039
	ACTTAGATGCGCCCTGGATGGGAATTCAAAGTCTTCAGATATCAGAGGCCAGTAAAACGGATAAACATGAGACTGAAGAAAGCTCTGTAGTAGGACTTTC
	TAGCCCAGAGTTGAAGGTCAGACCTGCTGTTGCCTCCAGTAATTGCTATACAGAAGGTGAAAAGCAGCTAACAAAATCTCTAAAAGGAAAGAATGAAGAA
	TCAAATAAATCCAAGGTTAAGGTCACTAAGCTCATGAAAACAATGAAACCAGAAAACACAAAAAAGTTAATAAAACAGAACTCTAAAGATTCTGTGGTTT
	TAGTAAGCTACAAATGTTTGAAAACTACAGCCTCAAGTGATTTCACTAAATGCTTGGAAGGCAGTCCTTCACATAGTCAGAAGGAAGGTCTGGATCCCAC
	ACTGTGTGCAGGTAATTTTGACCCAAAGACCTACACCAGACAGCCAAGTCAAAAGGAAGCTAGCTCTTTGTCAGCTAACACAGACAGAAGTGAACATAAG
	TCTCCAGATACTGAAAATATGCAACCAGACCAGTTCGAGCTCTTGAACTCTGGCAGCCTAAATCTTTGTGCAAATTTGTCCATTTCAGGTAAACTTGCTA
	TATCCCAAGACAATAGTGATATTCCAGATACGGAACACAATCTGGCATCTACAAGTTCATCAAATGATTGCCATGACTATCAGACAACCCCATCTTCGGG
	AGTTAGAACACTTGAAGTCAAGTCCAGCAGTAAAGAGTCTTTCAATGGAGAGAAAATTACTGTTAAAATAGGACCTTGGACAGAGCTTCAAGAAGCTGAA
	CTATTTGTGGATAATTTACTGCCAGATTTTGAGGCCTTAGACTCTAATGATAAACCCAAGTCTATAGATATACCACTTGAAAGGGATGCTTTACAGGAGA
	CAAAATGTCATTCTACTGAAGAATCATTAACTAAATTCAGAAGTAATCTACCTGCTCCTTCTACAAAAGAATATCATGTTGCAGTAAGTAGTGACACGAT
	TAAATTACCAGACACTAATGCCACGTATGCCTCCTCTAGATTCTCAGATTCAGGTGTTGAAAGTGAACCAAGTTCTTTTGCAACACATCCAAATCCGGAG
	ATAGCCTTTGAGACTCTCCAAGGGCCAGGTCCTTGCAATAATGAAAGGTTATTTCCTCAGCTTTTGATGAAGCCTGATCACAATGTAAAATTTTCATTAG
	GAAGTCATTGCACTGAGAGCACAAGTGCTTTAAGTGAAATACAGTCATCTTTGACATCCATAAACTCCCTGCCTTCAGATGATGAACTGTCACCCGATGA
	CAACTGTAAGAAGTCTGCTGTGCCTGACTGTCATCTAAGTGACAGTAAAACTGTATTCAATCTAGGAACAATGGATCTGCCAAAATGCGACGATACTAAA
	AAGTCAAGTATTATTTTGCAACAACAAAGTGTTGTTTTTTCAGGACATTTGGACAATGATACGTTAGCAATGCATTCCTTAGATTTAAGCACTGAGGACC
	CTTTACGGCTCGTTTTCTTGGATGAAGATGCTTCTAGTGGTGTGAGAAGTAGCTGGGGCTCCAAACCTCATTTGGATGCTCCCTTTACAGGCCCCCAGAG
	TCAGGGTACATCTAGTAACAACTCCACGGAATCAGTGCCAACACTAAATTCAAAACTGATTTGCTTAGGTTCTCCCTGTGTGGTCTCAGGTTCTGTTTGC
	ACTGATGCAGGGCTCAGTGCAGATAGAACTGTGGAAGGAAAGAGCGGTGAGCCATTAAATCACAAACAAGTGTGTTCAGCAGCCCCTGTTGTGGAAAGTG
	ACCCTCTTTCCAGCAGTACTGATGTGGTAAAACAAGGGCTGGTGGAAAATTATTTTGGATCTCAGAGCACTACAGATGTTTCTGATGCATGTGCTATTAC
	CTGCCACAGTCCAGTTAGCTCTCAGGAAACCTGCGACAAAGGGATTAGTGATCTGCAGCAGGAACAGGGCAAAGAGGAGGAAGAGGAGGATCAAGAAATG
	GTTCAAAATGGGTATCATGAAGAAACAGATTTTTCAGCTACGGATGGAACAGTAAGTGTTCACTATATAAGTGGAAACGAGTTAGGAGAAGGAAGACATG
	AACAGTCTGAAAAACTAAGCAGCAACTATCTGAGTGCTGGTGTGACTGTTCCTGCTGTTTGTACATCTGGTTGTTTGTCCTTCCCATCTGCTCTGCGAGA
	GTCTCCTTGTGTTAAATATTCTTCTAGAAGTAAAGTTGATGCCATTACAAAGCAACCAAGCAGCATTTCTTACAACTTCAGTTCTTCAACCTCCTGGTAT
	GAAAATTCACCAAAACCTCAAATACACGC
Exon18a 24033662 - 24033608
	AACAAAGGGTGACTGATCTTTAGTAAAGGCTGTTTCCTATAACACTTCACTTCAG
Exon18b 24033607 - 24033551
	CTTCCTTCAGGCAAAAGAAGAGCTGAAGCAACTCAGACTGCCTGGTTTCATGTACAG
Exon18c 24033550 - 24033447
	TGATGTTCCTCTGCTGGCATCCTCAGCACCGTACTTCAGCATGGACGAAGAGGACGGCTCTGAGGACGGCGTGCATCTCATTGTCTGTGTCCATGGTCTA
	GATG
Exon19 24031712 - 24031621
	GAAACAGTGCAGATCTCCGACTAGTAAAAACATACATTGAACTTGGACTGCCTGGGGGAAGAGTTGATTTTCTTATGTCTGAGAGAAACCAG
Exon20 24031149 - 24031052
	AATGATACTTTTGCTGATTTTGACTGCATGACTGATCGCCTTTTGGATGAGATCATACAGTATATTCAGATATATAGTTTAACAGTCTCAAAAATAAG
Exon21 24028844 - 24028693
	CTTTATTGGACATTCGTTAGGCAATTTAATAATCCGTTCAGTGCTTACAAGGCCAAGGTTTAAATATTACCTCAGCAAACTTCATACCTTTCTCTCTCTT
	TCTGGACCTCATCTTGGTACACTCTACAACAGCAGTGCTCTCGTCAATACAG
Exon22 24027624 - 24027514
	GTCTCTGGTTTATGCAGAAATGGAAAAAATCAGGCTCTCTTTTACAGTTGACATGTCGAGATCATTCAGACCCTCGCCAAACATTTTTATATAAGCTTAG
	TAATAAAGCGG
Exon23 24021731 - 24021618
	GACTTCATTATTTCAAGAATGTTGTGCTGGTTGGATCCCTGCAGGATCGCTATGTTCCTTACCATTCTGCCCGCATTGAAATGTGTAAAACAGCTTTAAA
	GGACAAGCAGTCAG
Exon24 24019336 - 24017597
	GACAAATCTATTCCGAAATGATCCACAACTTGCTTCGCCCAGTTCTGCAAAGCAAAGGCTGTAATTTGGTTCGGTACAATGTCATTAATGCGTTGCCCAA
	CACGGCTGATTCGCTCATCGGAAGAGCTGCACACATAGCTGTTCTTGATTCTGAGATATTTTTAGAGAAGTTTTTCCTGGTTGCCGCCCTCAAATATTTT
	CAGTAGGACCGAAGCATCATTAGAGACTTACCAATTACCTCATTCAGCAGTGATTTAAATAATGTATTATAGTTGTGTAGATGCTAAGTTTATGACATAT
	TTATACCTTTTTATATGGAAGATAATTTATATCATCCATGTGTAGAGCCTTTTAAACATCAACTTTACTTTCTAGGTAATGTGGCTGTGCAATAGTTTTT
	TAATTTTATCTTTTTACTTTTCTATTTTTCATATATTTTGCTACCTAAGTATTTCAGTGAACCTTGTGCCCATGTGTATGTCTGATCTTTTATTATTGGC
	TTCCACGATCCTTATTCAGACTATATCACATTAAGAGCTGTTATTGCTAGCATAGTATTTTAAATTCTCTAATTTGGGGCTTTTGGTGGACAATAAATTT
	TACCTTTAACACTTTATTCTGTTTAAACTGGAAGTAAAATAATGGCTGCTAAAATGTATTTTTGAAATCAACTTCTTTAATCCTAAGATATTAAATTTAC
	ATTTGATCAAACCAGGTGGTTCATACATGCCAATGTTTTAAAGGTTTTCTATAAAATCATATTGTTGCTGTTAAATGTGTCATGCTTATTAAAATATATT
	TTTACTGGTAATTTCAACATTATTTCTCATGTTGACTTTTATTACTGGAACTTTTCTTGTTCATGACGAGCGTATAAAGATTTTGACTGCCCTCTGCCGT
	GACTTGGCTGTAATTTTGTTGGATTTAATAATGTTGCTTGAGCTTCTCACAGCAGCTCTGTGACCCTTTTCATAGAGTTCCTTGTACAGAATAATTAAAT
	GTGGAAAGTTATGAAATACTTTTATGAATTTAGATAATTTTTAGATACTATTAAAATTTATCAGGCTAAAAAATCATGTAAATCAAATATTCAGTTTAAA
	ATTGAGAGACAATTAACTTTACATGTTTGGTGGTACAAATGCAGGTGTTTTTGATACATGAAAATATTGAGTCTTTACAAAAGGTGCTGATTAGCATTAA
	ATTCACTATTTTTCCTCCTGTTTTACTTGTGAAAACAGTAATGCACTGAGGGTGAGTAGAAAGGACTGTTTCCGTTCACCGATTGCTGTGGACAAAGGGT
	TGTTGAGTCTGTGTTGTGTATAATGGGTGCGTGTTTATTTTTAGTATCCTGTTAATTGCCTCTGATGTTAATAAAGGAGCAATGCCCTTTCTGCAGGGAT
	AGCAATGACATTTGTAATGCTTGCTTACTCCAAGAATGCTTGGGCGTGCAGCAGTGGCCTGAATAACACTCCTCAATGCTGGATCAGTTCCACAGTGGCA
	TGGCCACCCAGCCTCGGGGGATCCTGGGCTCGCTGCACAGCACCCAGATCTCTTCTGAGAATGTGTTCCCATCATTAAGTGATAAATGGTTGCCTGTGAT
	TTCATCCATAACTCGGTAGTGTAATCTTTCAGATATACCAAGTTCTTAAAGAATTTCATTGatttttttataattatttactttttaaaaattattcaaa
	atttttattaaCTGAACTAAGCAATAAATTTTCCAAAGGT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1a2-0
23+1dbEST_BY152155.1,
1b3+26dbEST_BI738374.1,dbEST_CN674768.1,dbEST_BB607311.2,dbEST_CN674760.1,REF_NM_026604.4,GB_AK053786.1,GB_AK149303.1,GB_AK081262.1,GB_AK165306.1,
34+28dbEST_CN536727.1,dbEST_CN461840.1,dbEST_BI738374.1,dbEST_CN674768.1,REF_NM_026604.4,GB_BC070446.1,GB_AK053786.1,GB_AK149303.1,GB_AK081262.1,GB_AK165306.1,
45+29dbEST_CN534274.1,dbEST_CN536727.1,dbEST_CN461840.1,dbEST_CA880065.1,REF_NM_026604.4,GB_BC070446.1,GB_AK053786.1,GB_AK149303.1,GB_AK081262.1,GB_AK165306.1,
1b5+1dbEST_BB863980.1,
56+31dbEST_CN534274.1,dbEST_CN536727.1,dbEST_CN461840.1,dbEST_CA880065.1,REF_NM_026604.4,GB_BC070446.1,GB_AK053786.1,GB_AK149303.1,GB_AK081262.1,GB_AK165306.1,
67+24dbEST_CN534274.1,dbEST_CN536727.1,dbEST_CN461840.1,dbEST_CA880065.1,REF_NM_026604.4,GB_BC070446.1,GB_AK053786.1,GB_AK149303.1,GB_AK081262.1,GB_AK165306.1,
78+18dbEST_CN534274.1,dbEST_CN536727.1,dbEST_CN461840.1,dbEST_CA880065.1,REF_NM_026604.4,GB_BC070446.1,GB_AK053786.1,GB_AK149303.1,GB_AK081262.1,GB_AK165306.1,
89+14dbEST_CK635777.1,dbEST_CN534274.1,dbEST_CN536727.1,dbEST_CN461840.1,REF_NM_026604.4,GB_BC070446.1,GB_AK053786.1,GB_AK149303.1,GB_AK081262.1,GB_AK165306.1,
910+22dbEST_CB525675.1,dbEST_CO045228.1,dbEST_CV560157.1,dbEST_EL606438.1,REF_NM_026604.4,GB_BC070446.1,GB_AK053786.1,GB_AK149303.1,GB_AK081262.1,GB_AK165306.1,
1011+9dbEST_CO045228.1,dbEST_CV560157.1,dbEST_CK635777.1,dbEST_CK391775.1,
1012+11dbEST_BG261666.1,dbEST_CD578594.1,dbEST_CB525675.1,dbEST_EL606438.1,REF_NM_026604.4,GB_BC070446.1,GB_AK053786.1,GB_AK149303.1,
1112+9dbEST_CO045228.1,dbEST_CV560157.1,dbEST_CK635777.1,dbEST_CK391775.1,
1213+21dbEST_CV557351.1,dbEST_CO434187.1,dbEST_CN535455.1,dbEST_BG261666.1,REF_NM_026604.4,GB_BC070446.1,GB_AK053786.1,GB_AK149303.1,
1314+1dbEST_EL606438.1,
1415+1dbEST_EL606438.1,
1315+24dbEST_CN528889.1,dbEST_CV557351.1,dbEST_CO434187.1,dbEST_CV560232.1,REF_NM_026604.4,GB_BC070446.1,GB_AK053786.1,GB_AK149303.1,
1516+24dbEST_CN528889.1,dbEST_CV557351.1,dbEST_CO434187.1,dbEST_CV560232.1,REF_NM_026604.4,GB_BC070446.1,GB_AK053786.1,GB_AK149303.1,
1617+22dbEST_CN455140.1,dbEST_CK639527.1,dbEST_CV560232.1,dbEST_CV556508.1,REF_NM_026604.4,GB_BC070446.1,GB_AK053786.1,GB_AK149303.1,
1718a+1GB_BC066812.1,
1718b+16dbEST_CV557081.1,dbEST_BB664162.1,dbEST_BQ564972.1,dbEST_BY718842.1,REF_NM_026604.4,GB_AK034175.1,GB_AK044359.1,GB_BC031160.1,GB_BC070446.1,GB_AK019549.1,GB_AK087116.1,GB_BC083093.1,GB_AK012197.1,
1718c+1dbEST_AI048411.1,
18c19+18dbEST_BB664031.1,dbEST_CV557081.1,dbEST_BB664162.1,dbEST_BQ564972.1,REF_NM_026604.4,GB_AK034175.1,GB_AK044359.1,GB_AK142968.1,GB_BC066812.1,GB_BC031160.1,GB_BC070446.1,GB_AK019549.1,GB_AK087116.1,GB_BC083093.1,GB_AK012197.1,
1720+0
1920+20dbEST_BG403994.1,dbEST_BB664031.1,dbEST_CV557081.1,dbEST_BB394215.1,REF_NM_026604.4,GB_AK034175.1,GB_AK044359.1,GB_AK142968.1,GB_BC066812.1,GB_BC039976.1,GB_BC031160.1,GB_BC070446.1,GB_AK019549.1,GB_AK087116.1,GB_BC083093.1,GB_AK012197.1,
2021+20dbEST_BG403994.1,dbEST_BF320617.1,dbEST_BB664031.1,dbEST_CV557081.1,REF_NM_026604.4,GB_AK034175.1,GB_AK044359.1,GB_AK142968.1,GB_BC066812.1,GB_BC039976.1,GB_BC031160.1,GB_BC070446.1,GB_AK019549.1,GB_AK087116.1,GB_BC083093.1,GB_AK012197.1,
2122+19dbEST_CB204486.1,dbEST_BG403994.1,dbEST_BF320617.1,dbEST_BB664031.1,REF_NM_026604.4,GB_AK034175.1,GB_AK044359.1,GB_AK142968.1,GB_BC066812.1,GB_BC039976.1,GB_BC031160.1,GB_BC070446.1,GB_AK019549.1,GB_AK087116.1,GB_BC083093.1,GB_AK012197.1,
2223+22dbEST_BQ180037.1,dbEST_CB204486.1,dbEST_BX522221.1,dbEST_AW744140.1,REF_NM_026604.4,GB_AK034175.1,GB_AK044359.1,GB_AK142968.1,GB_BC066812.1,GB_BC039976.1,GB_BC031160.1,GB_BC070446.1,GB_AK019549.1,GB_AK087116.1,GB_BC083093.1,
2324+20dbEST_BQ180037.1,dbEST_CB204486.1,dbEST_BX522221.1,dbEST_AW744140.1,REF_NM_026604.4,GB_AK034175.1,GB_AK044359.1,GB_AK142968.1,GB_BC066812.1,GB_BC039976.1,GB_BC031160.1,GB_BC070446.1,GB_AK019549.1,GB_AK087116.1,GB_BC083093.1,