NIA Mouse Gene Index (mm92)

Exon structure for U021300

chr1 -

Exon1 46944915 - 46944833
	CTCACTCAACGTACCTCTCAACAGATGAAGTTAAGCAGGTCCCGAACGTGGATTGACTTGTTTTATGATTCAAGGTTCTGATG
Exon2 46910891 - 46910316
	TCGGCCTAGGACGCTCGTTCTCCAGGCTTCTACGTCTCATCCGCTAGCCCAAGGCCTCAGCAACCGACGTGCGAGGCCAGGCGAGGCGACCAAGGCCGTT
	CCACGCATGCGTTAAAAGCCGCCCCAACTCCCCCCAATCCCCGAGGAGTCCTTTCTCAGAACAAAACTAGCGCGGAGCTACAGAGCTCCGCAATTTGCGT
	AGATCTAATTTCTTCCAGTTGCCGCCAGTCGGTGTAGCTCCCGCCGGTGCCGCCGCTCTCCTACGCCAGGCGCGTCCGCGAAGTGAATGGCTGAACGCTG
	CCGGTGCGCCGCCGGCGTAGCGCCGATCAGGCCGAGGTGCGGCTGCGCAGGGCGCCCGAGCGGGCCGGGTGCGCCGCCGGCGTAGCGCTGAGGCGGCCAG
	GGTGCGGCTGCGCAGGGAGCCGGAGCAGGCTGAGTGCGCCGTCGGCGTAGAGCGCCGGCTCTCGCGCTAGGCTCCGCGACGCAGATAGCGCAGGCGGCTT
	TGGAGAATACACGACTGGGTGCAGCCGGGGTTTGGTACCGAGCGGAGAGGAGATGCACACGGCACTCGAGTGTGAG
Exon3 46892996 - 46891972
	GAAAAGTAGAAATGAAGGTGCATATACACACAAAGTTTTGCCTCATCTGTTTACTGACATTTATTTTCCATCATTGCAACCACTGCCATGAAGACCATGA
	CCATGGCCCTGAGGAGCTTCACAGACATCATCGTGGGATGACAGAGTCAGAGTCAAGCAAATTTTCAGTGCAGGATGCTGAAAATGAAAAAAAGTACTAT
	ATTGAAAAACTTTTTGACCGTTATGGTGAAAATGGAAGATTATCATTTTTTGGTCTGGAGAAACTTTTAACAAACTTGGGCCTTGGAGAGATCAAAGTCG
	TTGAGATTAATCACGAGGACCTTGGCCATGATCATGTTTCTCACTTAGACATTCTGGCAGTGCAAGAGGGAAAGCATTTCCATTCGCATACCCACCAGCA
	TTTTCACAATCATTTAAATGCAGAAAATCATACTACAACCAGTGTGACATCAAAAAGAAACCACAAATGTGATCCAGAGAAAGAGGCAGCTGAACTGCCC
	ATCAAAGCTGATGATAAACACCTGCATGACCGCAATCACCGCTTCCATCATCGCCATCGTTTGCATCATCACCTGGATCACAACACTACTCGTCACGTTC
	ATAATGACTCCGTTGCTCACAGTGAGCATGGGGAGCCCGGTCACAGCCCTTCACCAGAGACCAATAAAACACAAGAGCAGTCTGAAGTGAAGTCAGTGAA
	GGTCAGGAGGAAAGAAAAAGGGAAGAGGAAGAAAGAAAACTCGGAGGTTAATACACCAGGTTTCCTCCCCAACCATGATCACAGTGAACAATATGAGCAT
	AACCGGGTTCACAAACTTGACCGTGTACATAGCCCTGGCCATCCTCATGCGCATCTTCCTGAGCACAGTGGTCATGAGCTTGGCCATGGACACCAAGAAC
	TTGATCCTGATAATGAAGGTGAACTTCGACATACTAGAAAGCGAGAAGCACCACATGTTAGAAAAAGTGCAATTTATTCCACCCCTAGCCACAAAGACCA
	GAGTGAAGACGACCGCCAGCATGAA
Exon4 46889608 - 46889401
	TGTTTGAACGTCACTCAGTTGTTAAAACACTTTGGTCTTGGTCCGAACTCTCCCATCTCACCGGATCTATTCACGTACCTTTGCCCTGCATTGCTGTATC
	AGATCGACAGCAGACTTTGTATTGAACATTTTGACAAACTTTTAGTTGAAGATTTAAATAAGGATAAAACTCTGGTTCCTGAAGATAAGACAAATATAGG
	GGCATCGG
Exon5 46884357 - 46884188
	CGTGGATCTGTGGCATCATATCTATCACCGTCATTAGTCTGCTTTCCTTGCTGGGTGTGATTTTGGTTCCCATCATCAACCAAGGATGCTTCAAATTCCT
	TCTCACGTTCCTTGTTGCACTAGCAGTAGGAACAATGAGTGGAGACGCCCTTCTGCATCTACTGCCCCAT
Exon6 46883126 - 46882938
	TCTCAGGGTGGACATGACCACAGTCATCAGCATACGCACGGACATGGTCATTCACATGGGCATGAATCTAAGGAGTTTTTGGAAGAATATGATGCTGTGT
	TGAAAGGACTTGTGGCGCTAGGAGGCATTTACTTACTGTTCATCATAGAACACTGCATTCGAATGTTTAAGCACTACAAGCAACAAAGA
Exon7 46877488 - 46877368
	GGAAAACAGAAATGGTTTATGAAGCAGAGCACAGAAGAATCCACTATTGGAAGAAAGCTTTCAGATCATAAGTTAAACAGCACACCGGATGCTGACTGGC
	TCCAACTCAAGCCCCTTGCTG
Exon8 46876278 - 46875910
	GAACGGATGACTCGGTAGTCTCTGAAGACCGGCTTAATGAGACTGAACTGACGGATTTAGAAGCCCAACAAGAATCCCCTCCTAAAAATTACCTGGGTGT
	GGAGGAAGAGAAAATCATGGACCATTCTCACAGTGATGGACTGCACACCATTCATGAGCACGAGGTCCACGTGACCTCACATAACCACCATGATGAGGAT
	AAAGCAGTGCTGAGGAAGCACAGCCACCAGTGGCACCACAGACACGCCCATCATTCTCACGGGCCCTGCCACTCCGGCTCAGACCTGAAGGAAACAGGAA
	TAGCCAATATAGCCTGGATGGTGATCATGGGTGACGGCATCCACAACTTCAGTGACGGCCTCGCCATTG
Exon9 46874988 - 46874908
	GGGCAGCTTTCAGCGCGGGGCTGACTGGAGGCATCAGCACATCCATAGCCGTCTTCTGTCATGAACTGCCACATGAATTAG
Exon10 46869021 - 46868831
	GTGATTTTGCAGTTCTTCTAAAAGCAGGCATGACCGTAAAGCAAGCAATTGTGTACAATCTGCTCTCTGCCATGATGGCTTACATAGGAATGCTCATAGG
	CACGGCAGTCGGTCAGTATGCCAACAACATCACACTCTGGATCTTCGCAATCACTGCCGGCATGTTCCTCTATGTGGCCTTGGTGGATATG
Exon11 46866956 - 46863562
	CTTCCAGAAATGCTGCATGGAGATGGTGACCATGAGGAGCATGGCTTCTGTCCAGTTGGGCAGTTCATTCTTCAGAATTTAGGACTGCTGTTTGGATTCG
	CCATCATGCTGGTTATTGCCCTCTATGAAGACAAAATTGTGTTTGACATCCAGTTCTGACCATTCCCAGCATCTCTGTTGATTGCGAGAATGCTCGTGCA
	GCTTGCCTCTGTTCCTTGTACTGTATGCACGTCGCTCAGAGAATCCAGTGGCCTGCACTATTTACAGGTTCTGTAGATTTGAGCCTAACCACGAAAGACT
	GGTGTTCAGTACTGTTTTCTCTGCATGAATGGGTCTTTTAAAAGTTTGCGATAAAGTCAGAACATGGAACTCCGTGTACCAATATTGATAGAAGTTTAAG
	AGAATCATATAAAACACTAGTCTTTTTATTAGTAGAAACTTCTGTTGCTATGCAGAAATAGAAATTAAACCaaaaaaatcatttaaactttaaaaatatt
	ttaaatGGACATTGAGCAGACATTTTTGCGTGTGTGCTATGAATGATTTTAGTGCCCTCTATTCAGCTAAATACATACATATGGGATTAATAGGGATCAA
	CTTGACACAACTTTGAAACTGTATAAAGTTGATTTTAGGAACTAGAGGGAAGCCCAGGCTGCACTAGAGTATGGATTTAGCATTGGGGAAAGCCCTTATT
	CTTGAATCTAGAGTTACTATTTTTGTATATATTTGCATAGTGTTCAAACTTGCAGCCTAAACTACTGAAATTTGTGATTGTATGTTTGTGTGAACTTCAG
	TTTAATGAAAGATTCATAATGGTTCTTTGCATACTATACTTGGTGTTGGATTTTTCTTTTTAACTTTGTTTTTATGGGGGGGGTGAGTCAGAGGATGTAG
	TCAGATACCTTTTTCTTAACATTACTGCTCTAGAAAAATATCAAACAAATGGCATTCCATTTCCCTAGTACTAACTAGGTTAATTGGAAATTTTAAGTTC
	TGGGTGTTCATGTTATTTTACCAGTTTGGCATTTGGAACTCGGAGCACATGCTGTGGCTGGTAGTAAAAGCCAAGTTTGCCATGCCTATAGTCTGTATAT
	AGAATGTCAGCTAAATGCTTACTGCACTGGTACCATAGCTACTTTGGTACCAAGTATATGACTAAGCCAAAATCACTTCTATCATTTTGTGCCAAGATAC
	ACTGCTGGTGCCTGAAATGGAGCGGTCAGTGTTTGGGTGCCTGCTCTTACACCACTGGGGCAGTGATGTGTGAGAAGTCTAAGTCACGTTTCGTCTGATT
	GTGACTCATAACTTGTAGACTAGTCATGTGCATACAGCTGTTTACATCCCATGCCACCCACTCTTCATTTATACAGGCAAATGTCTGAACCGTGTGCAGC
	TAGCTCTATTTTAACTGCTTGGCAGCCAGGATATCCCTTGGGAAAAACCACATAAGAGCCAAACCCTGGCCTTTCCATTTTAAATATTTTTATTCAGTCC
	CTTCTCTGGTTCTTTTCCTCTTACTCTGATTTTCCTTTTAAGACAAAAACAAAAATTTGAGGGCAACACATGCGACCAGGTGTCAGAGGTCAATCTCCAA
	TATTTCTTTGATATGTTATAAGCAAGGGTTATTTGGTCTTACAGCAGTTGTCTCTTTCTCAGCCCTCCTTGCAGTAAGTGGTTTTGCACACAAGTTTTCA
	GCACTGGGCATGCCTATGACAGTCATTACTTCACCTCATTGCTTGGCCCTTTGAGCAACCTTGCTAAAAGGTGCTGGTGTGCTCAGTGCTGTCAACTTCA
	AGTGACTGGGATATTTTGCTTTCAAAACCAAGATACACTTATCCTTCAGTTTTGAGTTTGATTTTCAAGGAGGGTTGTGCATTCCAGCATTACATCTCCT
	TCATTTCAAACAACTGCGGGAATATACTCCCACTCTAAAATGCTTCACAAAGCTGTTATGCCTACAATATACAAAGTTTTATATTCTCAAACAAATGGTA
	TTATCTTTATTTGCTAGATTTTCTTAGTCATTTCAGGGGGCTTTAACAGTTGCTGCTAGTATTTTGATAGTGTTCCACCAGTATTTAGTTTTTACATCAT
	TCTAGTGTATAGTTTCAGGTCTCATTAGACAATCCTAATTCCACTACATTTCTGTTTGACTCCAACATTCCACTTAGCTTGACTAGCCTAATTTTAACAT
	GCTTGTTGGAGGTCACCAATATTACTTGTATGATGCTGTCACCATGTGACATCCATAAAGATTTTGGTGTATACCACATTGCATTCAACCAGCTGTGATT
	ATGCTTAGAAATACTATAGTAACTAGATGCAGTGTGAACCTTTTCCATTAACAGTAAGTCAGTGGCTTCAATGTGATTATGGTCCTGCAAGGTGATACTT
	GCTAAAATATCTAAACATTTTTGTTGTTGTGACTGAATCatttttttttaaatttataaaGCTGGAAGTGATGAAATGCTGTTTTTTCATTGTCAACAGT
	GGTGTGTCATTTTATATATGTTCCTAATGCTTACGGAACTCTCCCAAAATAAAGTTATTCAGAAAGTGTGTGGTGTGTTTTCATTGTCTGTCTCATAACA
	CTGAATCTTCATTGGTACTTTAAAGAGGCCAGAATAAAGTCATAATTAAGAACATTAAGTTTATTTAAGCCAAAGCAAAATTTAAACGGTAAAATGTGTT
	TTATTCAGTCTAACAAGAAGTTGCAAGAGATGATGCCACCTTCAGATTATGAGTTTAGTTGACACAGCAGTGCCACACCCCGTCCAATCCAGTGTTCCTT
	GGGTTGGTCAGAGGGAAGAATCATGGCAATCACGAAATTTGTAGAGTGGCCAGTGGTGGAGAGTGTGCCCCTCCTCTCGCTTGTCTTATACAGTGGAGCA
	ACATAACTTGGTCGTTTGGATATGTCTGACTTTTTGCATGGCTTTAGCCACATCTGGAAGAAAGCACAAACACCTCTAAGTCAGAGCCATTAACCATCAT
	GTACTTTAGCTACTGTGATAGTTCCAGAGTAAGGTTATGTCTAAAACCTATGCCCTACATAGATTGTATTTTTTGTCAACAGTGAAATGATTGTTCGAAT
	ATAAAGATGCCTAACTATCTCAGAACCAGTATACAAAGAGAAAACAGTTTGCCTCTGTTAGAAGTATAGTGCCCACTCGTGTATGCTTTCGATATTATTT
	GGTTTAATTGGACTAGCCTTGGAAATGTTACCATTTTTACTCTTTTTCTACAAAGAAAGTATTCTTAGTAAACTTAATTATAACCCATACTTAGTAGTGG
	TTTCTTAACAGGTTGTATGCAAAATGTTTTTACAGTGAACAGTTACTTTATACAATACTGCATTGTGCCATAATAAAGACTAATTGCTTAAAAGC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+2dbEST_CK392729.1,NIA_K0849C06-5,
23+16dbEST_CN537239.1,dbEST_CN456246.1,dbEST_BU057097.1,dbEST_CK391213.1,REF_NM_172653.2,GB_BC062918.1,GB_BC052880.1,
34+36dbEST_CN526844.1,dbEST_CB518436.1,dbEST_CN456099.1,dbEST_BU504452.1,REF_NM_172653.2,GB_AK122483.1,GB_BC062918.1,GB_BC052880.1,GB_AK136117.1,
45+32dbEST_CK639097.1,dbEST_CF742706.1,dbEST_CN531226.1,dbEST_CK391643.1,REF_NM_172653.2,GB_BC059214.1,GB_AK122483.1,GB_BC062918.1,GB_AK049099.1,GB_BC052880.1,GB_AK136117.1,
56+34dbEST_CN456226.1,dbEST_CN461662.1,dbEST_CF736258.1,dbEST_CV557963.1,REF_NM_172653.2,GB_BC059214.1,GB_AK122483.1,GB_BC062918.1,GB_AK049099.1,GB_BC052880.1,GB_AK136117.1,
67+39dbEST_CF738089.1,dbEST_CN525454.1,dbEST_CN456226.1,dbEST_CN461662.1,REF_NM_172653.2,GB_BC059214.1,GB_AK122483.1,GB_BC062918.1,GB_AK049099.1,GB_BC052880.1,GB_AK136117.1,
78+50dbEST_CD804513.1,dbEST_CF738089.1,dbEST_CA572288.1,dbEST_CN525454.1,REF_NM_172653.2,GB_BC059214.1,GB_AK122483.1,GB_BC062918.1,GB_AK049099.1,GB_BC052880.1,GB_AK136117.1,
89+36dbEST_CV784335.1,dbEST_CN458841.1,dbEST_CX205911.1,dbEST_CN526184.1,REF_NM_172653.2,GB_AK030685.1,GB_BC059214.1,GB_AK122483.1,GB_BC062918.1,GB_AK049099.1,GB_BC052880.1,GB_AK136117.1,
910+32dbEST_BU610831.1,dbEST_CV784335.1,dbEST_BQ769198.1,dbEST_CN458841.1,REF_NM_172653.2,GB_AK030685.1,GB_BC059214.1,GB_AK122483.1,GB_BC062918.1,GB_AK049099.1,GB_BC052880.1,
1011+38dbEST_BI082786.1,dbEST_CN529094.1,dbEST_BU610831.1,dbEST_BM225304.2,REF_NM_172653.2,GB_AK030685.1,GB_BC059214.1,GB_AK122483.1,GB_BC062918.1,GB_AK049099.1,GB_BC052880.1,