NIA Mouse Gene Index (mm92)

Exon structure for U021782

chr1 -

Exon1 135975737 - 135975489
	TCCCCGAGTGGTATGAAAGGCGCAGCCCGGGGAAAGTCCGGGCAGAGCCCGAGAGGTGGCCAGACCGTCATCATCGTTCTAATACAGCTACTTCCTCAGC
	CACCGGTATGAGCCACGGGAAGAGAACCGACATGCTCCCGGAGATCGCCGCCGCCGTGGGTTTCCTCTCCAGTCTCCTGAGGACTCGGGGCTGCGTGAGC
	GAGCAGAGACTCAAGGTTTTCAGTAGGGCGCTCCAGGACGCACTGACCG
Exon2 135974280 - 135971231
	ATCATTACAAACACCACTGGTTTCCAGAAAAACCATCCAAAGGTTCTGGCTATCGCTGTATCCGTATCAACCACAAGATGGACCCCATCATCAGCAAGGT
	GGCCAGCCAGATTGGACTCAGCCAGCCCCAGCTGCACCGGCTGCTGCCCAGTGAGCTGACCCTGTGGGTTGATCCCTATGAAGTGTCTTACCGCATCGGG
	GAGGATGGCTCCATCTGTGTCCTGTATGAGGAGGCCCCGGTGGCTGCCTCCTATGGGCTCCTCACCTGCAAGAACCAGATGATGCTGGGCAGGAGCAGCC
	CCTCGAAGAACTATGTGATGGCCGTCTCCAGCTAGATAGGAGCCACCCGACCCTGGCACTCTACTGTTCTCATGCTGCCCTGACAACAGGCCACCGTATA
	CCTCAACCTGGGGAACTGTATTTTTAAAATGAAGAGCTATTTATACATGTTTTTTTTTTTTTTTTTTAAGAAAAGAGGAAAAAAACCAAAAGATTTTTTT
	TAAAAAAAAAAGAAAAAGAAAAACAATTCTTTAAAGGGAGCTGCTTGGAAGTGGCCTCCCCAGGTGCCTTTGGAGAGAACTGTTCTTGATTGCATCTGTG
	AGCCAGTGTTTGCCTAGGGGAATGGGTTGGGGATTGGCCTAGCCAAGGTAAAAGGGGATTCTTGGCTGATCCCCCCAGGAGGTGGTGGAAGGGAGCAAGG
	TTAGCAACTGTGAATGAGAGGGGTCAGGGTCTGCTCTGGGTTACCGTCCCAGCTGGGATGCCTGTATGCCTGGTCCCTCTCTTACTCAGGGGCATTCAAG
	CCTGATCTTAAATAATACTACATTGCCTAATCTTCTCTTTTGTTTTTCGGCTGAGATCAGGGGCAGACTGAAAGGCCTCTCCTGTCCCTTCTGTTCTAAG
	CAGTCTCTTGAAGCCGTGTCTCGTTTCTGAGTCTACCCTTGGGGGCCTGAAGAGCTTGCTTCCCAGCCCGGAATCTGTCTAAACATTTTTTGGAGGGTGG
	GATGTAAGGCAGGCGCGCAAAGACTTTGGGGCTAAGATGGAGAGGACCTGCACAAAACCTTTGCTTTGCTCTGTGCTGCTTTGTATGGGTGGATAGTGAA
	TAATTTAGGGATGATTTGCAATGGAATTTTGGGACCCAAAGAGTATCCAATGGGGGTAGGTCTTTTGGACCCAGTCCTTCCTTTTGGGAACCACACGACA
	GTCTGAATGCTGCTACCACTATTCCTTTGAGAGGTGGCTCAAAGCTCCAGGGAACTCCAAGTCCTTTCTTACTGCCTTCTCTTCAAGAGCAACCTTCCCC
	ATTTTTTCTTTCCCCTTTCCTGCGGTTGGGTCCTGGAGGGCCCTATTTCCTAGGACAAGCGTTCTCAGTCACTGTGCAATAGTCCCAGGATGCTCTGAGA
	CCGGACCTCCCAGCCCCTCCTGATGCCCTGGTAGGTTTTAGGGACCCATTCTTCCCATTCTTCTAGGGGTTCTGACTGGCTGGTGGGCCTTGCGGAGATC
	TTCCTGGGCCACAGGGAGGGCACCTGTGCACTGCAGGACTACCTGGTATTCTTGTAGGGCTGCCATGAAGAGTCAAACCTTGGGCACAGCTTTAGCTCCT
	TGGTGCTCAGAGCACCTGTGGGGGAGGTTACCTCTCTCTCTCTCTTAGTAAAATCCAAATTTATTTGTAGATGTGTGCAATATTTACTGTTCTGGGTTGG
	AGAAAATTGGGAAACACTGGGAAGAAATGGCTTTCCTTCAGGTTCAGTGACACTGATGAGGGCTTCTTAGAAGGCCTCAAGTCTCTCAAACTGAAGGACA
	GAGCTAGAGCTAGCCCGTCACCCCTTGGTGAGGATTCCCTTCCCCGTTTCTCTCCACCGCCATGGCATCCTGTGTCCTAGATTTCTCAGCTCCTCAGTTT
	CTGCTCAAAGGTGCTATTTACCAAACTCTCTGCCTGCCCGGGCAGACAGGCCCCAGCTTCGCACAGCCTTCCCAGGTGGCTTCGTCTCTCTTGCTTTAAC
	CTTAACTCTGGGCCCACAGACCTGAGAGCTGTGGCCTACAACAAAGCTGTGAATTGTTCCAGATGGTTCTTGTGTTTTGTCCGCACACAGGTGCCTGCCG
	TTTAGAAGCTGCCTCCTGGTCTCATGCTTAAATCTTCAATTCTTTACTGTCCTTGTTCACTTTAGAAATGACAAACCCTAGAGCTGGACTGTTGAGCAGG
	CCTGTCTCTCTTATTAAGTAAAAATAAGAAATAGTGGTAAGTTTGTAAGCTATTCTGACAGAAAAGACAAAGGTTACTAATTGTATAATAGCGCTTTTAT
	ATGGAAGACTGTACAGCTTTATGGACAAATGTAAACTTTCTTTTTTGTTTTTAATAAAAATGTAGCAGATCGTGTAATGTGTAGAGAAGGTGGAATTCCA
	TAGCGCTGACTGGCCCTCTTAGATACAAACCCCTTCGTGTTTCGTGGACTTCATCAGTTGTCCTGAGCTCCGTCTGCAGCATGCAGACGTTATAAAAGAT
	ACCCTAGGTTTGTGACGAGGTTGCTTCCATTGCATCCCCTCTCCTTGGGAGGCGGCTCCATACTTCTGTCCTTGTGAATATTGTCACAGGTCTCTTAAAA
	AACAAACAAACAAAAAAGCCCAAAAACCAATATGTTATCTGCACACTCTGCAGCCAGTTCCATAGTTTTGCTCTTGGCCATTCAGCACATTGAAGAGCTG
	GCCAGCTGTGtccacatctgcgcaagcaagccaccacggctggaaactatataaagaaaagaaaccatccagaaagttccaaagacacaagacttgggtt
	tggcacacactaagcacaccagtgcactcgatgcgactgcagttatacacaagcaCACCCTGATGTTCCTCCTGGCGTCCCAGAGGTCACCCGTGAGGCC
	AGCGTCTGAGCATGGTTTGTTTCACGCCCCGTTCATGCATAGCAGCACTGGTCTACAGtggcagtgtctttactgggcatgggcagacttttccttgctg
	ttctggaaacagtctagtttaacaactatttcccatgtattaggcactgc

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+129dbEST_BU503073.1,dbEST_CX203245.1,dbEST_CF582727.1,dbEST_BQ714653.1,REF_NM_007570.2,GB_BC138639.1,GB_BC132259.1,GB_AK133796.1,GB_AK169269.1,GB_AK169436.1,GB_AK088976.1,