NIA Mouse Gene Index (mm92)

Exon structure for U022043

chr1 -

Exon1 172995066 - 172994885
	AGCGCGGAGCGGCGGAGCCGTGGGTGTGGTCGGGGTTCGGGTCACCCACCCGGGCGTGCGCAGGGAGGGAAGTCAGCGGTAGGCGTCGTCGTGGAAGGCT
	CTGGGCTCTGTCCGGAGTCAGTCTGTCAGTCGGCGGCGTCGTGTGGGCGCCGTCCCAGCGGTGCAgcgttggtggtatagtg
Exon2 172989857 - 172989758
	GTCAAAGTTTCTTTGCTGAAGCTGCCTTGAGCCTTTCTGCATTGGCCTGTGAGGCAGTCCAGGAGTTTATGAAAACAGCATCGAATCAAGACTCGGGGCA
Exon3 172989525 - 172989400
	TTCATCTCCTGAACCTCATCAGACTCTGATCCAGTTCTTGAATGACTTTGGACACCCAGATGTTTCAGAATGCACACTCTGGAAGCCAATGGCTACTTCC
	ACCACTGACAATTCTGCTGCTGTTTG
Exon4 172988737 - 172988717
	CTTTTGCAGACAGGCAGAGTG
Exon5 172988079 - 172987822
	CAGCTCTTCCGAAGGCTGTGGTGAAACTGGACCCCCCATGGATCCAGGTGCTCAAGGAAGACATGGTGACACTGATGTGCGAAGGGACCCACAACCCTGG
	GAACTCTTCTACTCAGTGGTTCCACAACTGGAGTTCCATCCGGAGCCAGGTCCAATCCAGCTACACGTTTAAGGCCACAGTCAATGACAGTGGAGAATAT
	CGGTGTCAAATGGAGCAGACCCGCCTCAGCGACCCTGTAGATCTGGGAGTGATTTCTG
Exon6 172984324 - 172984070
	ACTGGCTGCTGCTCCAGACCCCTCAGCGGGTGTTTCTGGAAGGGGAAACCATCACGCTAAGGTGCCATAGCTGGAGGAACAAACTACTGAACAGGATCTC
	GTTCTTCCATAATGAAAAATCCGTGAGGTATCATCACTACAAAAGTAATTTCTCTATCCCAAAAGCCAACCACAGTCACAGTGGGGACTACTACTGCAAA
	GGAAGTCTAGGAAGTACACAGCACCAGTCCAAGCCTGTCACCATCACTGTCCAAG
Exon7a 172981983 - 172981675
	ACCCAGCAACTACATCCTCCATCTCTCTAGTCTGGTACCACACTGCTTTCTCCCTAGTGATGTGCCTCCTGTTTGCAGTGGACACGGGCCTTTATTTCTA
	TGTACGGAGAAATCTTCAAACCCCGAGGGATTACTGGAGGAAGTCCCTGTCAATCAGAAAGCACCAGGCTCCTCAAGACAAGTGACACCCCATCCATCGT
	ATGGCAAAACATCGGTGGCAGCAGCAACTTTTCAGCCACACAGCCTTCCTTTGAAAGCAACTTACAagcaggccgggatgtttggttcttcaatcacaac
	gacttagga
Exon7b 172981674 - 172981300
	ggctgaggaaggaggatcgccagttcaaggcctgcctgggtcatacagagagagtgagtgcaagtctagcctggataacccagtgagatcctgGGTTTag
	gcggctcatcaggaaagagaacctattgctaatctcacaaacaagatgcctactgcccatgtggccaaaggaaagaacaaggtcctggaagttgtcctct
	gacctccaccatccaccatggcaggtgcacacaATAAATTAAAATGTCATGTATATTTTTAAACAAGAGACAGGGGCAGGCTAAGGGTTGATGGCATAGC
	TGTTATCCAGTACACATAATGCCCTGGGTTTGACCTCCTATAATAAAGCAAAAAAAATCAACGGTGGGCTAAGGA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+2dbEST_CK137123.1,ENSMUST00000164179,
23+2dbEST_CK137123.1,ENSMUST00000164179,
34+159dbEST_BY193042.1,dbEST_AI097941.1,dbEST_BY174501.1,dbEST_BY202268.1,REF_NM_010188.5,GB_BC052819.1,GB_AK152875.1,GB_AK077227.1,GB_AK151795.1,GB_AK153384.1,GB_AK153449.1,GB_AK159919.1,GB_AK151557.1,GB_AK169887.1,GB_AK154892.1,GB_AK171289.1,GB_M14215.1,GB_AY897424.1,GB_AY897423.1,GB_AY897429.1,GB_AY897425.1,GB_AY897426.1,GB_AY897428.1,GB_AY897422.1,GB_AY897421.1,GB_AY897427.1,GB_AY897420.1,GB_AY897419.1,GB_AF197930.1,
45+134dbEST_AA797824.1,dbEST_AI573657.1,dbEST_BI653627.1,dbEST_BG247333.1,REF_NM_010188.5,GB_BC052819.1,GB_AK152875.1,GB_AK077227.1,GB_AK151795.1,GB_AK153384.1,GB_AK153449.1,GB_AK151557.1,GB_AK154892.1,GB_AK171289.1,GB_M14215.1,GB_AY897424.1,GB_AY897423.1,GB_AY897429.1,GB_AY897425.1,GB_AY897426.1,GB_AY897428.1,GB_AY897422.1,GB_AY897421.1,GB_AY897427.1,GB_AY897420.1,GB_AY897419.1,GB_AF197930.1,
56+100dbEST_CF615877.1,dbEST_CB204335.1,dbEST_AA547480.1,dbEST_DT905142.1,REF_NM_010188.5,GB_BC052819.1,GB_AK152875.1,GB_AK163401.1,GB_AK077227.1,GB_AK151795.1,GB_AK153384.1,GB_AK153449.1,GB_AK159919.1,GB_AK151557.1,GB_AK169887.1,GB_AK154892.1,GB_AK171289.1,GB_M14215.1,GB_AY897424.1,GB_AY897423.1,GB_AY897429.1,GB_AY897425.1,GB_AY897426.1,GB_AY897428.1,GB_AY897422.1,GB_AY897421.1,GB_AY897427.1,GB_AY897420.1,GB_AY897419.1,GB_AF197930.1,
67a+37dbEST_CF615877.1,dbEST_DT915379.1,dbEST_W82159.1,dbEST_BE647307.1,REF_NM_010188.5,GB_BC052819.1,GB_AK152875.1,GB_AK163401.1,GB_AK077227.1,GB_AK151795.1,GB_AK153384.1,GB_AK153449.1,GB_AK159919.1,GB_AK151557.1,GB_AK169887.1,GB_AK154892.1,GB_AK171289.1,GB_M14215.1,GB_AY897424.1,GB_AY897423.1,GB_AY897429.1,GB_AY897425.1,GB_AY897426.1,GB_AY897428.1,GB_AY897422.1,GB_AY897421.1,GB_AY897427.1,GB_AY897420.1,GB_AY897419.1,GB_AF197930.1,
7a1-0