NIA Mouse Gene Index (mm92)

Exon structure for U023252

chr2 -

Exon1 120796451 - 120796258
	CCTGACTTCAGGGGCCGTCGTAAAAGTGTCGTCCCTGTCGCGTCGGGCCGGCCACAGGTTTCCGCTAGCTGGCGGCCGGGGGTCGGGAACTGCGGGCGTT
	CGTTTCCCTTAAGATGGCGGACGAAGAGATGGACGGCGCCGAGAGGATGGACGTCAGCCCGGAGCCTCCCCTGGCCCCGCAGCGGCCGGCATCG
Exon2 120789356 - 120789100
	TGGTGGGATCAGCAAGTTGATTTCTATACTGCTTTCTTACATCATTTGGCACAATTAGTGCCAGAAATTTATTTTGCTGAGATGGACCCAGATTTGGAAA
	AGCAAGAAGAGAGTGTACAGATGTCAATACTCACTCCTTTGGAGTGGTACTTATTTGGAGAGGATCCGGATATTTGCTTAGAGAAATTAAAACACAGTGG
	AGCGTTCCAGTTGTGTGGGAAGGTTTTCAAAAGTGGAGAAACAACATATTCCTGTAG
Exon3 120786899 - 120786821
	GGATTGTGCAATTGATCCAACGTGTGTGCTCTGTATGGACTGCTTCCAAAGTAGTGTTCATAAAAACCATCGTTACAAG
Exon4 120781456 - 120781346
	ATGCATACTTCTACTGGAGGAGGCTTCTGTGACTGTGGAGACACAGAAGCGTGGAAAACTGGCCCTTTTTGTGTGGATCACGAGCCTGGAAGAGCAGGTA
	CTACAAAAGAG
Exon5 120775906 - 120775776
	AGCTTACATTGCCCATTGAATGAAGAGGTGATTGCTCAAGCCAGGAGAATATTCCCTTCGGTGATAAAATACATTGTAGAAATGACTATATGGGAAGAAG
	AAAAGGAATTGCCTCCTGAACTGCAGATAAG
Exon6 120773632 - 120773494
	GGAGAAAAATGAACGATACTATTGTGTCCTTTTCAACGATGAGCACCATTCGTATGATCATGTGATCTACAGTCTGCAGAGAGCTCTAGATTGCGAGCTT
	GCAGAGGCACAGCTGCACACGACTGCCATCGACAAAGAG
Exon7 120772420 - 120772358
	GGTCGCCGGGCTGTCAAAGCAGGTGTGTATGCCACTTGCCAGGAAGCAAAGGAGGATATAAAG
Exon8 120772133 - 120772010
	AGTCACTCAGAGAACGTCTCTCAGCACCCCCTCCATGTGGAAGTGCTGCACTCCGTGGTTATGGCTCACCAGAAATTCGCTCTGCGCCTTGGCTCCTGGA
	TGAACAAAATTATGAGCTATTCAA
Exon9a 120771677 - 120771570
	GTGACTTTAGACAGATATTTTGCCAGGCCTGCCTCGTAGAAGAACCTGGCTCTGAAAATCCCTGTCTTATAAGCAGACTAATGCTTTGGGATGCAAAACT
	TTATAAAG
Exon9b 120771569 - 120771194
	GTAAGTAGACCTCTACTTATGCTATGAGCAGGGTCAGGGGAAGGTTATAGCTTCACCATAGAACCGAGGTCTGTCTCGTGTGAAATCAGTTATTGAACAC
	GATCTTGATTTGTGTTATTTGTGAAGGCAAGGTTAACTAATTTAATTTTTCTGGTTAAAAATCCAGGAATACTGTCTTTTAACAATAGTGCCTTTCATTT
	AGAAAGGGCTAATTGAAAAGTGTTTAATCagctgggcggtggtggcgtacacctttaatcccagcactcgggaggcagaggcaggtagatttctgagttc
	gaggccagcctagtctacaaagtgagttccaggacagccaggactattcaaagaaaccctgtctcgaaaaaaaacc
Exon10 120770475 - 120770387
	GTGCCCGTAAGATCCTTCATGAATTGATCTTTAGTAGTTTTTTTATGGAGATGGAATACAAAAAACTCTTTGCTATGGAATTTGTGAAG
Exon11 120768311 - 120768213
	TATTATAAACAGCTGCAGAAAGAGTACATCAGCGACGACCACGAGAGAAGCATCTCCATAACCGCCCTGTCCGTGCAGATGCTCACCGTCCCGACCTTG
Exon12 120766860 - 120766703
	GCCCGGCATCTTATTGAAGAGCAGAATGTTATTTCTGTCATTACTGAAACGCTGCTAGAAGTTTTACCTGAATACTTGGACAGGAACAATAAATTCAACT
	TCCAGGGTTATAGCCAGGACAAACTGGGAAGAGTCTACGCAGTTATATGTGACCTAAA
Exon13 120761051 - 120760952
	GTATATCCTGATTAGCAAGCCTGTCATATGGACAGAACGATTAAGAGCGCAGTTCCTGGAAGGTTTCCGGTCTTTTCTGAAGATTCTTACCTGTATGCAG
Exon14 120760168 - 120760040
	GGAATGGAAGAAATCAGAAGACAAGTTGGACAACACATTGAAGTGGACCCTGACTGGGAGGCTGCCATCGCTATACAGATGCAACTAAAGAATATTTTGC
	TCATGTTCCAAGAGTGGTGTGCTTGTGAT
Exon15 120756762 - 120756582
	GAAGATCTCTTACTGGTGGCTTATAAAGAATGTCACAAAGCTGTAATGAGGTGCAGTACAAATTTCATGTCCAGTACCAAGACAGTAGTGCAATTGTGCG
	GTCATAGTCTGGAAACCAAATCCTACAAAGTGTCTGAGGACCTTGTAAGCATACACCTGCCACTCTCTAGAACACTTGCTG
Exon16 120756078 - 120755901
	CCtttttcattttttaaaaagatttatttatttactacatgtaagtacactgtagctgtcttcagacacctgagaagagggcatcagatctcattaagga
	tggttgtgagccatcatgtggttgctgggatttgaactcaccacctttggaagagcagtcagcactcttaaccactga
Exon17 120755518 - 120755457
	GTCTTCATGTACGTTTAAGCAGACTAGGTGCTATTTCAAGACTGCATGAATTTGTGCCTTTT
Exon18 120755232 - 120755122
	GACGGCTTTCAAGTAGAGGTCCTGGTGGAGTACCCGCTGCGCTGCCTGGTCCTGGTGGCTCAGGTTGTTGCTGAGATGTGGCGAAGAAACGGGCTCTCAC
	TCATCAGCCAG
Exon19a 120752133 - 120752096
	TCAATTCCTTTAACATCTGTCTACCATTTCTTTCACAG
Exon19b 120752095 - 120752030
	GTTTTCTATTATCAAGATGTTAAATGCAGGGAGGAAATGTACGATAAAGATATCATCATGCTTCAG
Exon20 120751792 - 120751691
	ATTGGAGCATCTATAATGGATCCCAACAAGTTCTTGTTACTGGTACTTCAGAGATATGAACTTACTGATGCTTTTAACAAGACCATATCCACAAAAGACC
	AG
Exon21 120749931 - 120749868
	GATTTGATTAAACAGTATAATACATTAATAGAAGAAATGCTTCAGGTCCTCATCTATATTGTGG
Exon22 120747238 - 120747114
	GAGAACGTTATGTACCTGGAGTGGGAAATGTTACCAGAGAGGAGGTTATAATGAGAGAGATTACTCACTTACTTTGCATTGAGCCCATGCCACATAGTGC
	CATCGCCAGAAACCTACCTGAGAAC
Exon23 120743609 - 120743557
	GAAAATAATGAAACTGGCTTAGAGAATGTCATAAACAAAGTGGCCACATTTAA
Exon24 120742262 - 120742160
	GAAACCAGGTGTGTCGGGCCATGGAGTTTATGAATTGAAAGATGAATCACTGAAAGACTTCAATATGTACTTTTACCATTATTCTAAAACACAGCATAGC
	AAG
Exon25 120741152 - 120741104
	GCTGAACATATGCAGAAGAAAAGGAGAAAACAAGAAAATAAAGATGAAG
Exon26 120740757 - 120740603
	CATTGCCGCCGCCACCTCCTCCGGAGTTCTGCCCTGCTTTCAGCAAAGTAGTCAACCTGCTCAGCTGTGATGTTATGATGTACATCCTCAGGACCATCTT
	TGAGCGGGCAGTGGACATGGAGTCTAATCTGTGGACAGAAGGGATGCTGCAGATG
Exon27 120737833 - 120737734
	GCGTTCCATATATTGGCACTGGGCTTGCTGGAAGAGAAGCAGCAGCTTCAGAAAGCTCCTGAAGAGGAAGTGGCTTTTGACTTTTACCATAAGGCTTCAA
Exon28 120736947 - 120736838
	GATTGGGAAGTTCAGCCATGAATGCTCAGAATATACAAATGCTCTTGGAAAAACTCAAAGGAATCCCCCAATTAGAAAGCCAGAAGGACATGATAACATG
	GATACTCCAG
Exon29 120735244 - 120735158
	ATGTTTGACACAGTGAAGCGATTAAGAGAAAAATCTTGTTTAGTTGTGGCAACCACTTCAGGACTGGAGTGCGTTAAGAGTGAGGAG
Exon30 120732761 - 120732580
	ATTACTCATGATAAAGAAAAGGCAGAAAGGAAGAGAAAAGCTGAGGCCGCTAGGCTTCATCGCCAGAAGATCATGGCCCAGATGTCTGCCTTACAGAAAA
	ACTTCATTGAAACCCACAAACTCATGTATGATAATACGTCAGAAGTAACAGGGAAGGAAGACTCCATTATGGAGGAAGAGAG
Exon31 120729935 - 120729730
	CACCTCAGCAGTCAGTGAGGCCTCTAGAATTGCTCTGGGCCCTAAACGGGGCCCGGCTGTTACTGAAAAGGAGGTGCTGACGTGCATCCTCTGCCAAGAA
	GAACAAGAGGTGAAACTAGAAAATAACGCCATGGTATTGTCAGCATGTGTGCAGAAATCCACCGCCCTAACCCAGCACAGAGGGAAGCCTGTGGACCACT
	TAGGGG
Exon32 120727431 - 120727338
	AAACACTGGACCCTCTTTTCATGGATCCAGACTTGGCACATGGAACTTATACAGGAAGCTGTGGTCATGTAATGCATGCAGTGTGCTGGCAGAA
Exon33 120726386 - 120726237
	GTATTTTGAAGCTGTGCAGCTGAGCTCGCAGCAGCGCATTCACGTAGACCTGTTTGACCTGGAGAGCGGCGAGTACCTATGCCCGCTCTGCAAGTCTCTC
	TGCAATACTGTCATCCCCATCATCCCTTTGCAGCCGCAGAAGATCAACAG
Exon34 120722329 - 120722232
	TGAGAATGCGGAGGCTCTTGCTCAACTTTTGACCTTGGCCCGGTGGATACAGACTGTCCTTGCCAGAATATCGGGTTATAATATAAAGCATGCTAAAG
Exon35 120720901 - 120720808
	GAGAAGCCCCAGCAGTTCCTGTCTTGTTTAATCAAGGAATGGGGGATTCGACTTTTGAGTTTCATTCCATCCTGAGTTTTGGAGTTCAGTCTTC
Exon36 120718952 - 120718804
	GGTGAAATATTCAAATAGTATCAAGGAAATGGTCATTCTCTTCGCCACAACAATTTACAGAATTGGCCTGAAAGTGCCTCCTGATGAACTAGACCCACGA
	GTGCCCATGATGACCTGGAGCACGTGTGCGTTCACCATCCAGGCAATCG
Exon37 120717863 - 120717808
	AAAACCTGTTGGGAGATGAAGGAAAACCTCTATTTGGAGCACTTCAAAATAGACAG
Exon38 120715608 - 120715512
	CATAACGGTCTGAAGGCGCTAATGCAGTTTGCAGTTGCACAGAGGACTACCTGCCCTCAGGTCCTGATACACAAACATCTGGCTCGGCTCCTGTCAG
Exon39 120708024 - 120707957
	TTATTCTTCCTAACCTGCAATCAGAAAATACACCAGGCCTTCTGTCCGTGGATCTCTTCCATGTTCTG
Exon40 120706917 - 120706767
	GTCGGCGCAGTCTTAGCGTTCCCATCCTTGTATTGGGATGACACCGTGGATCTGCAGCCGTCACCACTTAGTTCTTCATATAACCACCTCTATCTCTTCC
	ATCTGATCACCATGGCGCACATGCTTCAGATACTCCTTACAACAGATACAG
Exon41 120702794 - 120702695
	ATCTGTCTTCAGGGCCGCCGCTTGCTGAGGGTGAAGAGGATAGTGAGGAGGCTCGCTGTGCATCTGCTTTCTTTGTGGAAGTGTCGCAGCACACAGACGG
Exon42 120701235 - 120701102
	CCTCGCTGGGTGCGGTGCTCCCGGCTGGTACCTGTGGCTCTCCCTGAGGAACGGCATCACCCCTTACCTCCGCTGTGCTGCACTGCTTTTCCACTATTTA
	CTTGGAGTAGCTCCGCCTGAAGAACTGTTTGCCA
Exon43 120698968 - 120698860
	ATTCTGCTGAAGGAGAATTCAGTGCACTCTGTAGCTATCTATCTTTACCCACAAATTTGTTCCTGCTTTTCCAGGAATATTGGGATACCATAAGGCCCTT
	ACTACAGAG
Exon44 120697262 - 120697068
	tactgataccagaaaagcctgctgcaatcctgttacccactggtgactcAACCCAGGGCAACAGTGATGTCGTCTTTCCTCCCACTCCTCCGACCTGCAC
	TGGGGCAAATAGTTAAGGCTTTTTTTTTTCCTTTTTTTTAAAGGCCTTTTGTCTCAAGGGCCTTCTTGGTCCTTTGTCACTTCTCCTGGGAGTAG
Exon45 120696781 - 120696725
	GTGGTGTGGAGATCCTGCCTTACTCAAGTCTTTGAAGCAGAAAAGTGCTGTGGTCAG
Exon46 120694039 - 120693962
	GTACCCTAGAAAAAGAAATAGTTTGATAGAGCTTCCTGAGGACTACAGCTGTCTTCTAAATCAGGCTTCTCACTTTAG
Exon47 120692296 - 120692126
	GTGTCCACGGTCTGCAGATGATGAGCGAAAGCATCCTGTCCTCTGTCTTTTCTGTGGGGCCATCCTGTGTTCTCAGAACATCTGTTGCCAAGAAATAGTG
	AATGGGGAAGAGGTTGGAGCGTGCGTTTTTCATGCGCTTCATTGTGGTGCTGGAGTCTGCATTTTCTTAAA
Exon48 120690155 - 120690054
	AATCCGAGAATGCAGGGTGGTCCTGGTGGAAGGAAAAGCCAGAGGCTGTGCCTACCCAGCCCCTTACTTGGATGAATATGGAGAAACAGACCCAGGGCTA
	AA
Exon49 120688527 - 120686005
	GAGAGGAAACCCACTTCATTTATCTCGGGAGCGGTATCGGAAGCTGCATTTGGTCTGGCAACAGCACTGCATTATAGAAGAGATTGCTCGGAGCCAGGAG
	ACTAATCAGATGCTATTTGGATTCAACTGGCAGTTACTCTGAGCTCCAGTTCTGCCTCAAGACAATCATGAGTGACATCAATAATAAAGACTGATCTAAA
	ATTCTAGAGAACTTTCTGAGGACGGGGAAGTATTGGAGGGTCTTTTGATCCATGTCCAGATTCACACACATTAATAAAATATTCCTTAATGGAATATTGC
	TTTCAATTATCAAACATAAGCTTCAAGGGAAAAACAAGACATAGATTAATGTTTTATGTTCTAGAACACTAAAGAAATGCTTGTTCATCCAAGTGTCTAT
	TTCTGCTAATATTTCCAGAAAACTCCTTTCCCTTCATAACTGTCCTAGTTCATTTCATATCACCCACCTGGTTAATGAGGTCACATTAAGCATTTGTGGA
	CATTTCTCCATCTGGCTAACATCTCTGCACCTTTGTATTTGGTGTTTCTCGAGTGTAGTTTAGCTTGGGTTAGATCTGAAAAGATGCTGATCACCTGTGA
	TGGTCTAAAGAGGAATTGCACAACTATGCAGTTTCTTTCAATTAAAAATTTCAAAACATGTAAACATCTTTCTTCTTTAAGGAAATATCCTTATTGTACC
	ACCTACGGCTTCAGTCAGAAACAGATCTAAATCTCTCTATGGAGAGTGCTAGCTGTGCTAGTCTGGAAAGCATCCTTCCAGTATAGACCTCAAGTAGATT
	CAGGAGAATGTGCTCATTACGCATTCCTTATACAAAAGCCTGTTATCCTCACCTGATTCCAGGGAGCTCTGTGGAGTCACAAGTTCTCCATCAGTTACAT
	TTCTTAAGGCAGATTTCTGCAGTAAGATCTCGTCTCTTGGGGCCCCATCCTATTGTCTCTCAGAAAACTCTTGTTTTGAAGCAAACTCTTTGTAGAATGG
	GAATCAGAAAATTGCCCCAGTGAATGGTCATAAGAGATGAAATTAGAACACTGTATTTAAGCCAGTTCTGCAACCTTCTATGGCTTGTAAGAAACAGGTC
	CTTGATTTGATGTCTAGGTGAAACCTTTCATAAACGACTGTTTATGATTAATATAAACAACAATAACAAAAAAGCAACGTAATCAGGTGTGTGTCCTGTT
	ATAACCTGCTGTGGTTGAGCCATCTTGCGTATAAATAATGCAGCTCTCCTGAGTCTGTGCATAGACCTCTTGATTCTTGGCTTTACCGTTTTATATCAAG
	ACCTTGTGAGTAGATCAGTTGATACTTATTTTAGCTTTTGTGGTATTGGGTAATATTGCAGTTGAAAGATGTGTTTGGAGATTGTCTCTTCCTTTGCCCT
	TGGCTACTGCTGCCATGTGTGTGTCTAAGTGTTTTCCTGCCTTCTGTTTAGTGAAGACCAGGAAGTAAAAATACATTTGATAAGTGATCAGTGATGCACA
	TTTGGGGCTAAATTTGTTGCCATTTTTATGGAATGAAAAGTGGGTTTTGCAGTAAGAAATTGGTGTGAGCAGGCACCAGACTCACAATCATGATTTCCTA
	CTTGGATAAATACTACTCAGAAGAAAGCAGGAACTAGATGCAACTATAATGAACAGTTCACAGCAATTATAAGAGACAAAAATCAATAAATTCAGTATTT
	GGCTTGTGCCATTTGCCAATATGATTAAGAAATTTGAACATTGCCCTTTGTTTTTTCTATAATTTTTTTTTGAGAGATTGTTTAGCTCTGAAATCTGGGC
	TAGAATAGGCAACATAAGATGCTCATTTCTGCCTTAGTCATCTGGCCCCCATTTGCCAAGGATAAAGACTTTATTTTTAGCCTTCTTAGATTCAATTTGT
	AAACCCTGGAGCTAAGCTTTCAAGCTGCTAGGAGGACTAGCTAGCACTAGCCAAAGAGCCTAATTCATCACTCAGTTCTGCTTCTTGAGATGGAAGTTTC
	TGCACTGGAGGTAGACTTAGGTCACAGTGCTGCCCCAGCCCACGGGATCTTTAATAGTATTCATCATGACAAATGATTTAAGTCTGCTAAGAAGTTTACT
	TAAGCAACCAAGTCACTTTATGTAGTGTAGTGTATGAAAGAATTGGTTTAGTGGGATGGCTCTGACTCTGTGTTTTTAATATTGGTGAGGGGCTGGCAAG
	GATTTTAATGATACAGTAAAGATAAACATATATCTGTATAATTAATTTATTCTGTTAGTGTATGGGCTGTGAGTTCACCTTTTAGTGGTCATTTGTCATT
	TCATAACAACTATGCATTTTGGTTCACTGTGATGATGATCTATATTTAGTGACTGCAACATGTTTATACCACTGATTCAAATTCCATTCATGATGAAGTT
	ATACAGATGATGCATATATTGATATCTTTTATTGCAAAAATGTAAATTAAAAACTTGTATAATGTTCTTGTGCTTTTTTGAAATAAAATATCTTATATGT
	GTATATTTAAAAAGAAAAAAGGG

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+28dbEST_BY736138.1,dbEST_CJ051457.1,dbEST_CB232501.1,dbEST_BY750548.1,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,GB_AK162013.1,
23+19dbEST_BY736138.1,dbEST_CJ051457.1,dbEST_CB232501.1,dbEST_BY750548.1,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,GB_AK162013.1,
34+17dbEST_BY736138.1,dbEST_CJ051457.1,dbEST_CB232501.1,dbEST_BY750548.1,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,GB_AK162013.1,
45+18dbEST_AI615529.1,dbEST_BY357438.1,dbEST_AA553166.1,dbEST_BY736138.1,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,GB_AK162013.1,
56+13dbEST_AI615529.1,dbEST_BY357438.1,dbEST_AA553166.1,ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,GB_AK162013.1,
67+10ENSMUST00000028728,ENSMUST00000133408,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,GB_AK162013.1,
78+10ENSMUST00000028728,ENSMUST00000133408,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,GB_AK162013.1,
89a+12dbEST_CA870285.1,ENSMUST00000028728,ENSMUST00000133408,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,GB_AK162013.1,
9a10+8ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
1011+9dbEST_AW489271.1,ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
1112+8ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
1213+9dbEST_BE650873.1,dbEST_AW489271.1,ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
1314+9dbEST_BE650873.1,ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
1415+10dbEST_DV046421.1,dbEST_BE650873.1,ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
9b16-0
1517+9dbEST_DV046421.1,ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
1718+12dbEST_AI504731.1,dbEST_BM114217.1,dbEST_BY756516.1,dbEST_DV046421.1,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
1619a+1ENSMUST00000154023,
1819b+13dbEST_AI504731.1,dbEST_BM114217.1,dbEST_BY764809.1,dbEST_BY756516.1,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
19b20+15dbEST_BM114217.1,dbEST_BY764809.1,dbEST_BY756516.1,dbEST_DV046421.1,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
2021+20dbEST_BM114217.1,dbEST_BY572650.1,dbEST_BY572440.1,dbEST_BY572180.1,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
2122+20dbEST_BM114217.1,dbEST_BY572650.1,dbEST_BY572440.1,dbEST_BY572180.1,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
2223+20dbEST_BM114217.1,dbEST_AV142930.1,dbEST_AV225341.1,dbEST_BY572650.1,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
2324+18dbEST_BM114217.1,dbEST_AV142930.1,dbEST_BY572650.1,dbEST_BY572440.1,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
2425+10dbEST_BY473336.1,dbEST_BM114217.1,ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,GB_BC090969.1,GB_AK132284.1,GB_AK166885.1,GB_AK089616.1,GB_BC100461.1,
2526+4dbEST_CV557953.1,ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,
2627+6dbEST_CV557953.1,dbEST_BY473336.1,ENSMUST00000028728,ENSMUST00000129790,REF_NM_009461.2,GB_AF061555.1,
2728+6dbEST_CV557953.1,dbEST_BY473336.1,ENSMUST00000028728,ENSMUST00000129790,REF_NM_009461.2,GB_AF061555.1,
2829+5dbEST_CV557953.1,ENSMUST00000028728,ENSMUST00000129790,REF_NM_009461.2,GB_AF061555.1,
2930+3ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,
3031+4dbEST_CV556567.1,ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,
2931+2dbEST_CV557953.1,ENSMUST00000129790,
3132+7dbEST_CN537568.1,dbEST_CV556567.1,dbEST_CV557953.1,ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,
3233+6dbEST_BU703363.1,dbEST_CN537568.1,dbEST_CV556567.1,ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,
3334+6dbEST_BU703363.1,dbEST_CN537568.1,dbEST_CV556567.1,ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,
3435+5dbEST_CF744465.1,dbEST_BU703363.1,ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,
3536+5dbEST_CF744465.1,dbEST_BU703363.1,ENSMUST00000028728,REF_NM_009461.2,GB_AF061555.1,
3637+9dbEST_CK635421.1,dbEST_CN670969.1,dbEST_CN676885.1,dbEST_CF744465.1,REF_NM_009461.2,GB_AF061555.1,
3738+10dbEST_CK635421.1,dbEST_CN670969.1,dbEST_CN676885.1,dbEST_CF744465.1,REF_NM_009461.2,GB_AF061555.1,
3839+12dbEST_CB519911.1,dbEST_CK635421.1,dbEST_CF907445.1,dbEST_CN670969.1,REF_NM_009461.2,GB_AF061555.1,
3940+14dbEST_CF726597.1,dbEST_CB519911.1,dbEST_CK635421.1,dbEST_CF907445.1,REF_NM_009461.2,GB_AF061555.1,
4041+17dbEST_CF741991.1,dbEST_CF726597.1,dbEST_CB519911.1,dbEST_CD554621.1,REF_NM_009461.2,GB_AF061555.1,
4142+15dbEST_CF741991.1,dbEST_CF539210.1,dbEST_CF726597.1,dbEST_CB519911.1,REF_NM_009461.2,GB_AF061555.1,
4243+14dbEST_BG862813.1,dbEST_BB622408.1,dbEST_CF741991.1,dbEST_CF539210.1,REF_NM_009461.2,GB_AK078173.1,GB_AF061555.1,
4345+13dbEST_CN528381.1,dbEST_BG862813.1,dbEST_BB622408.1,dbEST_CF741991.1,REF_NM_009461.2,GB_AK078173.1,GB_AF061555.1,
4445+2dbEST_CB588645.1,ENSMUST00000153868,
4546+15dbEST_CN528381.1,dbEST_CB588645.1,dbEST_BG862813.1,dbEST_BB622408.1,REF_NM_009461.2,GB_AK078173.1,GB_AF061555.1,
4647+14dbEST_CN528381.1,dbEST_CB588645.1,dbEST_BG862813.1,dbEST_BB622408.1,REF_NM_009461.2,GB_AK078173.1,GB_AF061555.1,
4748+16dbEST_BQ745596.1,dbEST_CV563315.1,dbEST_BE573578.1,dbEST_CN528381.1,REF_NM_009461.2,GB_AK078173.1,GB_AF061555.1,
4849+15dbEST_BQ745596.1,dbEST_CV563315.1,dbEST_BE573578.1,dbEST_CN528381.1,REF_NM_009461.2,GB_AK078173.1,GB_AF061555.1,