NIA Mouse Gene Index (mm92)

Exon structure for U023391

chr2 -

Exon1a 132073543 - 132073525
	ACGTCACTTCCGCTGGGCT
Exon1b 132073524 - 132073506
	GTCCTTAAGACCGCCCCTT
Exon1c 132073505 - 132073369
	CCGCTTGGCTGTTGAGCGAGCCTTGCGAGCGCGCCTAACGGAGAACGGGGAGCGCAGCGCGGGTAGGGGGCGGGCGCGCGCTCCCGGAAGCCAGCCGCGA
	GACCTGGCCCTGCCACCGAGGCTGCTTCCCGGAGACA
Exon1d 132073368 - 132073332
	GTTAGTTCACGTTGGCGGCGGCGGAGGGCGACGAGAG
Exon1e 132073331 - 132073309
	GTTGTCCACAGCGCCACGCTTAG
Exon2 132071810 - 132071692
	ACTAGCTGTGTTACTCTGTTATGATGCCGTCTCGTACCAACCTGGCAACTGGACTCCCCAGCAGTAAAGTCAAATATTCAAGGCTTGCCAGCACAGACGA
	TGGCTACATTGACCTTCAG
Exon3 132071108 - 132071056
	CCTTAATCTGTCTCTGAAGCTTAACCTTGAGCTGAATCTACTTATGATGCGGG
Exon4a 132069877 - 132069790
	TTTAAAAAAAGCCCTCCTAAGATCCCTTATAAGGCCATTGCCCTTGCTACCGTGCTGTTTTTGATTGGCACCTTTCTCATAATCATAG
Exon4b 132069789 - 132069755
	GCTCTCTCCTGCTGTCGGGCTACATCAGCAAAGGG
Exon5 132066362 - 132065228
	GGGGCAGACCGAGCCGTTCCTGTCCTCATCATAGGCATTTTGGTGTTCCTACCGGGATTTTACCATTTGCGCATCGCCTATTATGCATCCAAGGGCTACC
	GGGGTTACTCCTACGATGACATTCCAGACTTTGATGACTAGCCTTCGCCTCAGCCTTGAGAAGAGTCGCACACAGTGCAACCACTTTAAGACATCAAGCA
	AGAACTCTGGCTAAGGGCTGAAGAAGTCTACAATTTGCAGATGTTTAGCAAAACAATGGCCAGATTGTATGAGTCCTTCTCCAAAACGCTCCTGCTTTAT
	AATTAGCTAATTAGGACATGGTATGTTTTCATCTCCTGGCCCTGGCTAAACTTGACAAGTTTTTCCACATGAGTGTGCATCATGTAAGAGTTGTGAAGCT
	AACTGTCTGGGAAGGCAGCCTGTTCTATAGTGGAAGGTGTTACCCTCCTTAGAGCTGAACCTTTCTTTTGTCTTCCATTGTCTGCTTGGTTTTGTAGCAT
	AATGGGAAATGTATTGTCTAGTTTCTTATTACTAAGTAATTTATTTTTAAAATTACCTATCTTATCTCTCACCCTCTCCTCTACCATTATATCCTAGTAA
	AATTAAAGTATCTGTCTTACCTTCATATGCTCCTCCACCTTCATATCCCAGTAAAACCAAATATCTGTAGATCCATCTCTAATTGGCTTTTTTTACATTG
	ACAGCAACCTGGAATTTTTAAACCATGAAGCTGGGTATTAtgatcccagtacttgggaggcagagccaggtggatctctatgagttcaaggccagcctgg
	tctacatagagttttacgacaactagggctacctagtgagaccctgtctcaagaaaaGGGAAACTTCCTCTGGTTTCTCCATAGTTTGCCTACTACAAAA
	CTCAGGTGAATCTGTCCTTTGTAGGTCAAGAGATTGTGTGAATCATACCTCAAGGACTAGACTTTGGCTGTTTCTTCGTAAAACTGTAGATAAGTGTACT
	TAGAGTTTATAGCCCTACTGCTGGCTGGTACTATGATATCATTCTGCTAAAGATTACAAGACTTGGCCAAGATCCCTGAAAATGTATTAAGTCAAATCTG
	GTTCTCAGCTTATAAAAAGTGACAATTTTTTCTAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1d2+4dbEST_BG245031.1,dbEST_BF162116.1,dbEST_BY197228.1,ENSMUST00000110163,
1c2+4dbEST_BQ922165.1,dbEST_BU923358.1,dbEST_BB868462.1,REF_NM_001141971.1,
1e2+65dbEST_BY717520.1,dbEST_BI872332.1,dbEST_DN173983.1,dbEST_CX231577.1,REF_NM_027478.3,GB_BC033429.1,GB_AK017729.1,GB_AK170062.1,
23+2dbEST_BY099517.1,ENSMUST00000143782,
24a+67dbEST_BI647712.1,dbEST_BY717520.1,dbEST_BQ922165.1,dbEST_BI872332.1,REF_NM_001141971.1,REF_NM_027478.3,GB_BC080755.1,GB_BC033429.1,GB_AK017729.1,GB_AK170062.1,
24b+1dbEST_BY188762.1,
4b5+49dbEST_BI647712.1,dbEST_CX221524.1,dbEST_BY717520.1,dbEST_BQ922165.1,REF_NM_001141971.1,REF_NM_027478.3,GB_BC080755.1,GB_BC033429.1,GB_AK017729.1,GB_AK170062.1,