NIA Mouse Gene Index (mm92)

Exon structure for U023620

chr2 -

Exon1 163575975 - 163575795
	AGCGTGGGCGGGGCTGTGCCGGGGCAGCCCGGTAAAAAAGAGCGTGGCGGGCCGCGGTCTCTGAGAGCCATCGGGAAGCGACCCTGCCAGCGAGCCAACG
	CAGACCCAGAGAGCTTCGGCGGAGAGAACCGGGAACACGCTCGGAACCATGGCCCAGACACCCGCATTCAACAAACCCAAA
Exon2 163563960 - 163563899
	GTAGAGTTACACGTCCACCTGGATGGAGCCATCAAGCCAGAAACCATCTTATACTTTGGCAA
Exon3 163561988 - 163561943
	TGGGGAGGCAGAGACCCTGATGCAGGAAGAAGACTCCAAGGCAGAG
Exon4a 163561207 - 163561193
	GAAGAGAGGCATCGC
Exon4b 163561192 - 163561085
	CCTCCCGGCAGATACAGTGGAGGAGCTGCGCAACATTATCGGCATGGACAAGCCCCTCTCGCTCCCAGGCTTCCTGGCCAAGTTTGACTACTACATGCCT
	GTGATTGC
Exon5 163558733 - 163558590
	GGGCTGCAGAGAGGCCATCAAGAGGATCGCCTACGAGTTTGTGGAGATGAAGGCAAAGGAGGGCGTGGTCTATGTGGAAGTGCGCTATAGCCCACACCTG
	CTGGCCAATTCCAAGGTGGACCCAATGCCCTGGAACCAGACTGA
Exon6 163558108 - 163557993
	AGGGGACGTCACCCCTGATGACGTTGTGGATCTTGTGAACCAGGGCCTGCAGGAGGGAGAGCAAGCATTTGGCATCAAGGTCCGGTCCATTCTGTGCTGC
	ATGCGCCACCAGCCCA
Exon7 163556968 - 163556841
	GCTGGTCCCTTGAGGTGTTGGAGCTGTGTAAGAAGTACAATCAGAAGACCGTGGTGGCTATGGACTTGGCTGGGGATGAGACCATTGAAGGAAGTAGCCT
	CTTCCCAGGCCACGTGGAAGCCTATGAG
Exon8 163556288 - 163556217
	GGCGCAGTAAAGAATGGCATTCATCGGACCGTCCACGCTGGCGAGGTGGGCTCTCCTGAGGTTGTGCGTGAG
Exon9 163556135 - 163556034
	GCTGTGGACATCCTCAAGACAGAGAGGGTGGGACATGGTTATCACACCATCGAGGATGAAGCTCTCTACAACAGACTACTGAAAGAAAACATGCACTTTG
	AG
Exon10 163555812 - 163555748
	GTCTGCCCCTGGTCCAGCTACCTCACAGGCGCCTGGGATCCCAAAACGACGCATGCGGTTGTTCG
Exon11 163553982 - 163553853
	CTTCAAGAATGATAAGGCCAACTACTCACTCAACACAGACGACCCCCTCATCTTCAAGTCCACCCTAGACACTGACTACCAGATGACCAAGAAAGACATG
	GGCTTCACTGAGGAGGAGTTCAAGCGACTG
Exon12 163553379 - 163553280
	AACATCAACGCAGCGAAGTCAAGCTTCCTCCCAGAGGAAGAGAAGAAGGAACTTCTGGAACGGCTCTACAGAGAATACCAATAGCCACCACAGACTGACG
Exon13 163552787 - 163552036
	CAGGGCGGGTCCCCTGAAGATGGCAAGGCCACTTCTCTGAGCCTCATCCTGTGGATAAAGTCTTTACAACTCTGACATATTGACCTTCATTCCTTCCAGA
	CCTTGGAGAGGCCAGGTCTGTCCTCTGATTGGATATCCTGGCTAGGTCCCAGGGGACTTGACAATCATGCACATGAATTGAAAACCTTCCTTCTAAAGCT
	AAAATTATGGTGTTCAATAAAGCAGCTGGTGACTGGTATCTTGCAGCACATGGTGAATATGGTCTCGGGGCTGCTGGCTAGGATGCTAAGAAAGGAGGAG
	CCCTGGGCCCTACGCTGAGTGTCAGGCTGGGGAGCCAGGGTCTCTTTCCTGCAGAAGCGATTCTTTCCCAGAGGGGCTGTTGGAGCAGATGCTCCTGAAC
	TCTCCGCCCCTTTAACCAGTCCTTTGGatttatttttattatttttaaatatttaattatgtttatgtatatgggtgttttgcctgcttgtatgtatatg
	catcatgtgtgcctggtgccagaggtcagaaaagggtaccacctcccctggtactggaatttaggtagttctaacccaccatgtgcccatgtgcccacca
	gtggacagcaagtgagagccgactctctcttcctaccctgtcagccccagggatgaactcaggctgccaggctgggtagtaagtctctacccactgagca
	tctcacaggcccTTTTCAGGCTGTGGCAGGTGTGGGCTGTGGGTGGGTGAGG

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+79dbEST_AI326688.1,dbEST_CK128320.1,dbEST_CF550812.1,dbEST_CK021376.1,REF_NM_007398.3,GB_AK075899.1,GB_BC002075.1,GB_M10319.1,GB_AK167489.1,GB_AF483480.1,GB_AF483481.1,GB_CT010224.1,GB_CT010255.1,
34a+1dbEST_AV571210.1,
24a+82dbEST_AI326688.1,dbEST_CK128320.1,dbEST_CF550812.1,dbEST_CK129747.1,REF_NM_007398.3,GB_AK075899.1,GB_BC002075.1,GB_M10319.1,GB_AK167489.1,GB_AF483480.1,GB_AF483481.1,GB_CT010224.1,GB_CT010255.1,
24b+0
4b5+83dbEST_CB203182.1,dbEST_BI251408.1,dbEST_AI326688.1,dbEST_CK128320.1,REF_NM_007398.3,GB_AK075899.1,GB_BC002075.1,GB_M10319.1,GB_AK167489.1,GB_AF483480.1,GB_AF483481.1,GB_CT010224.1,GB_CT010255.1,
56+64dbEST_CK031106.1,dbEST_CB203182.1,dbEST_BI251408.1,dbEST_AI326688.1,REF_NM_007398.3,GB_AK075899.1,GB_BC002075.1,GB_M10319.1,GB_AK167489.1,GB_AF483480.1,GB_AF483481.1,GB_CT010224.1,GB_CT010255.1,
67+49dbEST_CK129516.1,dbEST_CK031106.1,dbEST_CB203182.1,dbEST_BI251408.1,REF_NM_007398.3,GB_AK075899.1,GB_BC002075.1,GB_M10319.1,GB_AK167489.1,GB_AF483480.1,GB_AF483481.1,GB_CT010224.1,GB_CT010255.1,
78+37dbEST_AA646681.1,dbEST_AA646698.1,dbEST_CK129516.1,dbEST_AA871702.1,REF_NM_007398.3,GB_AK075899.1,GB_BC002075.1,GB_M10319.1,GB_AK167489.1,GB_AF483480.1,GB_AF483481.1,GB_CT010224.1,GB_CT010255.1,
89+33dbEST_BY757465.1,dbEST_BF682338.1,dbEST_AA646681.1,dbEST_AA646698.1,REF_NM_007398.3,GB_AK075899.1,GB_BC002075.1,GB_M10319.1,GB_AK167489.1,GB_AF483480.1,GB_AF483481.1,GB_CT010224.1,GB_CT010255.1,
910+32dbEST_BM207211.2,dbEST_BE853222.1,dbEST_BM877010.1,dbEST_BM206509.2,REF_NM_007398.3,GB_AK075899.1,GB_BC002075.1,GB_M10319.1,GB_AK167489.1,GB_AF483480.1,GB_AF483481.1,GB_CT010224.1,GB_CT010255.1,
1011+33dbEST_BQ559341.1,dbEST_BM207211.2,dbEST_BE853222.1,dbEST_BM877010.1,REF_NM_007398.3,GB_AK075899.1,GB_BC002075.1,GB_M10319.1,GB_AK167489.1,GB_AF483480.1,GB_AF483481.1,GB_CT010224.1,GB_CT010255.1,
1112+46dbEST_CK129839.1,dbEST_AV089802.2,dbEST_AA871919.1,dbEST_BY463272.1,REF_NM_007398.3,GB_AK075899.1,GB_BC002075.1,GB_M10319.1,GB_AK167489.1,GB_AF483480.1,GB_AF483481.1,GB_CT010224.1,GB_CT010255.1,
1213+6dbEST_BE136737.1,dbEST_AI429519.1,dbEST_D19189.1,dbEST_D19191.1,