NIA Mouse Gene Index (mm92)

Exon structure for U024193

chr3 -

Exon1 82680405 - 82680230
	GTGGCCCCGAGGCGCGAGGACAGCACGAGCGCCACTGGCCACGCCCTGCCCCGTCCGGCCCCGCGGCGACTCCTCTGACCACCGCTTCCGCCCGCAGCGC
	CGATCCGAAGCTCTGGCGGCGGTTTGTGCTCGTTGGTCCAGGGATTTTTAGGTCTGGCCTCTGAAGACCCGACGGG
Exon2 82670569 - 82670408
	GAATTGCAACCATGAATGAAGAAAACACTGATGGTACAAATGGATGCAGTAAAGTGCGCACTGGCACTCAGAATGAAGCCGCATTGCTGGCTCTCATGGA
	AAAGACTGGCTACAACATGGTCCAAGAAAATGGGCAAAGGAAATTTGGTGGTCCTCCTCCAG
Exon3 82669594 - 82669127
	GTTGGGAAGGTCCACCTCCCCCTAGAGGTTGTGAAGTTTTTGTTGGAAAAATACCTCGTGATATGTATGAAGATGAACTGGTTCCTGTATTTGAAAGAGC
	TGGGAAGATATATGAATTTAGACTGATGATGGAATTTAGTGGTGAAAATAGAGGTTATGCTTTTGTGATGTATACTACTAAAGAAGAAGCCCAATTAGCC
	ATCCGGATTCTTAACAATTATGAAATTCGACCAGGGAAGTTTATTGGTGTGTGTGTAAGCTTGGATAATTGCAGATTATTTATTGGAGCAATTCCCAAAG
	AAAAGAAAAAGGAAGAAATTTTGGATGAAATGAAGAAAGTTACCGAAGGTGTTGTGGATGTGATTGTTTATCCAAGTGCAACTGACAAAACCAAGAACCG
	TGGGTTTGCCTTTGTTGAGTATGAGTCCCACAGAGCTGCTGCTATGGCCAGGAGAAAGCTGATTCCAG
Exon4 82668609 - 82667827
	GAACATTTCAACTCTGGGGCCACACCATTCAGGTAGATTGGGCTGATCCAGAGAAAGAAGTTGATGAGGAAACCATGCAAAGAGTTAAAGTTCTGTATGT
	AAGAAATCTAATGATCTCAACTACAGAGGAGACAATTAAAGCAGAGTTCAGTAAATTCAAGCCTGGCGCAGTGGAGCGAGTGAAGAAACTGAGAGATTAT
	GCCTTTGTTCACTTTTTCCACCGAGAAGATGCAGTGGCTGCCATGTCTGTGATGAATGGAAAGTGCATTGATGGAGCCAGTATTGAGGTAACCCTGGCAA
	AGCCAGTAAATAAGGAAAATACTTGGCGACAGCATCTTAATGGCCAGATCAGCCCCAATTCTGAAAACCTACTTGTATATGCTAACAAGGAAGAGAGTCA
	CTCCAAAAGTCTAGGCAAGCCACCAACTCTCCCCACTCGTCTCAATGGTCAGCATAGTCCAAGCCCCCCTGAGATTGAAAGATGTACTTACCCTTTTTTT
	CCTGGAACAAAGCTGACCCCAATTAGTATGTATTCTTTAAAATCCAATCATTTTAATTCTGCAGTGATGCATTTGGATTATTACTGCAACAAAAATAATT
	GGGCACCACCAGAATATTATTTATATTCAACAACCAGTCAGGATGGGAAAGTACTCTTGGTGTACAAGATAGTTATCCCTGCAATCGCAAATGGATCTCA
	GAGTTACTTCATGCCAGATAAACTCTGCACAACGCTGGAGGATGCAAAGGAGCTGGCAGCTCAGTTTACACTGCTTCATTTGG
Exon5 82646455 - 82646396
	ACAGGGAACACAGTCTCTTCAGCCTGGACCTGTGTAGAAGAATTTGGAGGAAATAAGCAG
Exon6 82642381 - 82642314
	GTCCTTTCTGATGTTGCTTGAGCTTATTCTCCTGCAGTTGGTCTCACTCCTGTTCGTTAAACATTAAG
Exon7 82641354 - 82641155
	ACTTCAATTTCCGTCGCAGCTCAATAAATAGTCTTTCCCCTGTTAGCACTACCCTCTCTTCTGGGACTCCCAGCATGCTTCCTTACACATCAAGGCCTTC
	TTCTTATCCAAGCTATCCCTTGTCACCAACAATATCACTTGCTAATGGCAGCCATGTTGGACAACGACTGTATATCTCCAATCAGGCCTCATTCTTCTGA
Exon8 82641062 - 82640445
	CTTTAAAAGCAAATATTTTAACATATTAAACAGCTATAATTCAGAATGACAAGAGTGGTAGGATTTGCAGAAATGCAATTAAAAGTTACTCAGTGATAGC
	AAACTACTACTGTTATTTTTAAGCTTTGGGGGTTTCCAATTCCTGAGCTTGAAAGGATTCCTGTTGTTTATGATTTTTGTATAACAACTTTGTAAAACAG
	CATTTTACAAATATTGAAAGTACTTAAAGACAGTGGTTGTACTAGATTAGATTACCAAGGATCGCTATCTATAGTGGAGTTTGAAACAGTTATGTAACCA
	GAAGCATCTAACTATTATGTAAAAAGAAATGATGAGACAAAAAAGATTAAGATGCAAATTTTTGGCAGAAGTAATGAAAAATCAGTCTACCTTTGTGGTC
	CTTGAAAGTAAGCAAATATTTTAGTTAATATTTGTTACAGAAATAAATTAAAACTTTGCTGTTAATATATTTAAGGTTTTTATAGTTATAATTCATTTAT
	GTTTTGATATTCATTACATTGTTTACATAAGAAGTGTTAATGTTTTTTAAATGTTGAAATCATGTGTTGTTTAATTTTTATACTTCAAATTCTTCAACAT
	TAAATATATGGCACTACT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+6dbEST_CJ131695.1,dbEST_CJ046636.1,dbEST_CJ047223.1,dbEST_CJ047211.1,REF_NM_001146328.1,
23+7dbEST_BB614510.1,dbEST_CJ131695.1,dbEST_CJ046636.1,dbEST_CJ047223.1,REF_NM_001146328.1,
34+2ENSMUST00000048647,REF_NM_001146328.1,
45+1dbEST_CA951348.1,
56+1dbEST_CA951348.1,
47+2ENSMUST00000048647,REF_NM_001146328.1,
78-0