NIA Mouse Gene Index (mm92)

Exon structure for U024974

chr4 -

Exon1 41587357 - 41586947
	cccgccgagctcagccgagctcagccgactccctcccgccgtagccgagcccagccgaacgcagccgagcccagccgaactcCTCGACGCTCCTGCCGCC
	GCCGCCCGAGTGCTGCcgagcgagagagcgagcgagcgagcgagctagcgGCCCCGGCCGCGGAGGAGGCGCCGCCCCAGGGGGAGGAGGTGCCCGCTCT
	CCGCAGACCGCCCGCGGCAGAggccggcccggtcgcgccccggcgggagcggccggcggaggctgcgcggcccagggggagggcccggggAGTGGACGTC
	GCCCCTGCCCGCCTCTCGCCGCCCCCCGCCCGCAGGCTCTGGAGCCTCAGTCGGCGCTGAGCATCCCGTTGTCCCGGACCCTCTCGCGGGCGCGCACCGG
	GCTCAACTCAG
Exon2a 41586034 - 41585764
	GCCCAGGACTGCAGGTGGGCATCTTCCCTGCCAAGAAGTCGCTGTGTGTGGACAGGACAGCCACCTTGGATGGTTGGCCACCCCAGAGTTGTGCCTCGGC
	ATGGGCCTTGCCGCTGAGGCAGCTCCACTGTCTGCGCTGGCCTGAGGGTGCTGTCTGTCATGGGGGCAGCCATCTCCCAAGGGGCTCTCATCGCCATCGT
	CTGCAATGGCCTCGTAGGCTTCTTGCTGCTACTGCTCTGGGTCATTCTCTGCTGGGCCTGCCATTCTCGAT
Exon2b 41585763 - 41585581
	CTGCTGACGTCGATTCTCTCTCGGAATCCAGTCCCAACTCCAGCCCTGGCCCCTGTCCTGAGAAGGCGCCACCACCCCAGAAGCCCAGCCATGAAGGCAG
	CTACCTGCTGCAGCCCTGAAGGGCTCTGGCCTAGCCTGGAGTCCTGGACCTGAGTATACCTGAGTCAGAGCGTGGAATCGGAT
Exon2c 41585580 - 41585174
	CCAAGAAGTCAGTCGGCCTGGGGTCCAGTCGATTTGACACTGGACCCAGCAGCCTAGATTGTAGCCAGCCTGGCTCCAAGAGAGGCCTGAGTGGCCCTAG
	AGAGAAAGGCCTGGAGGGGGGGTTAGGAGTTGGTGCTAGGGCCAGGGCCATCTGGACTCTGCTCCATCCCAAGGGCCAAGGGCTGAGTCCATGCCTTCCC
	TAGGCTCAGCACATCTGGGCTCCCTAGGTTGGGGAGCAAACGGGAACCCCATGGCAATAATGGGAGGGTGTCCAGGCTGGGCCCCTTCTCTGGTCCTCCC
	ACTGTTTGTTGGGTAATAAATGGAACTATGGCTTGCCCCGAGATTTCTTTTTTTAGGGGCTGTGTGGTAGAACAGAAAACAAATAAAGGTAGGAGGTGAG
	TGTCCAG

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12a+25dbEST_AA288179.1,dbEST_AA017970.1,dbEST_AA017976.1,dbEST_AA017959.1,REF_NM_027147.1,GB_AK009710.1,GB_AK050496.1,GB_BC021944.1,
2a2c-1GB_AK185326.1,