NIA Mouse Gene Index (mm92)

Exon structure for U025132

chr4 -

Exon1 59973582 - 59973382
	CTGAACCCAGAGCATATATAAAGACAAGCAAAGGAGCTGGGGAGTGGAGTGTAGGCACCATCACCAGAAGGACGTGGTCCTGACAGACAGACAATTCTAC
	TCCCTACCAAAATGAAGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTATTCATGCAGAAGAAGCTACTTCCAAGGGACAGAACTTAAATGTAGAAAA
	G
Exon2 59973044 - 59972911
	ATTAATGGGGAATGGTTTTCTATTCTCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGAACATGGCAGCATGAGAGTTTTTGTGGAGCACATCCATGTCT
	TGGAGAATTCCTTAGCTTTTAAATTCCATACTGT
Exon3 59972141 - 59972068
	TATAGATGGAGAGTGCTCTGAAATATTTTTGGTTGCTGACAAAACAGAGAAGGCTGGTGAATATTCTGTGATGT
Exon4 59971472 - 59971362
	ATGATGGATTCAATACATTTACTATACTTAAGACAGACTATGATAATTATATTATGTTTCATCTCATTAACGAAAAGGATGGGAAAACCTTCCAGCTGAT
	GGAGCTCTATG
Exon5 59971029 - 59970928
	GCCGAAAAGCAGATTTGAATTCAGACATCAAGGAAAAGTTTGTAAAACTTTGTGAGGAGCATGGAATCATTAAAGAAAATATCATTGACTTAACCAAAAC
	CA
Exon6 59970762 - 59970717
	ATCGCTGCCTCAAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAG
Exon7 59969929 - 59969676
	TGTTGAGTGGAGACTTCTCACCAGGACTCCAGCATCCTCTCTTCCGATCGATACAGCATTGGGTGACAAGTTCTGTGATCTGCTTTCCATCCTGTCTCAC
	AGAGAAGTGCAATCCTGGTCTCTCCAGCATGTTACCTAGGATAACTCATCAAGAATCAAAGACTTTCTTTAAATTTCTCTTTGACATACCCATGACAATT
	CTCCAAGAATTGCTTCCTCTTCCTGTTCAATAAATGATTACACTTGCACTTAAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+7dbEST_BF535758.1,dbEST_CK616872.1,ENSMUST00000075973,REF_NM_008648.1,GB_BC012227.1,GB_M16358.1,GB_EU882229.1,
23+8dbEST_BF535758.1,dbEST_CK616465.1,dbEST_CK616872.1,ENSMUST00000075973,REF_NM_008648.1,GB_BC012227.1,GB_M16358.1,GB_EU882229.1,
34+9dbEST_BF535758.1,dbEST_CK616157.1,dbEST_CK616465.1,dbEST_CK616872.1,REF_NM_008648.1,GB_BC012227.1,GB_M16358.1,GB_EU882229.1,
45+10dbEST_BF535758.1,dbEST_CK616157.1,dbEST_CK616809.1,dbEST_CK616465.1,REF_NM_008648.1,GB_BC012227.1,GB_M16358.1,GB_EU882229.1,
56+11dbEST_BF535758.1,dbEST_CK616103.1,dbEST_CK616157.1,dbEST_CK616809.1,REF_NM_008648.1,GB_BC012227.1,GB_M16358.1,GB_EU882229.1,
67+9dbEST_BF535758.1,dbEST_CK616103.1,dbEST_CK616157.1,dbEST_CK616809.1,REF_NM_008648.1,GB_BC012227.1,GB_M16358.1,