NIA Mouse Gene Index (mm92)

Exon structure for U025152

chr4 -

Exon1a 63157025 - 63156986
	AACAGTTCGCAAAGTCCGGGCTCCCGGCCGCGTGGCTCCG
Exon1b 63156985 - 63156446
	TGTgcgcccgggcggcgttggggcgcgggggcccgggcTGCTGCATGGTGGGCGGCCCGGGACATGCCCCGCACCCCCCGCCGGACGCCCGCGTGGCTCC
	TCTGGCTGCGACTGCTCCGGACTCTGAGCCTAGATTGACCGGCGCCCTAACTTCTTTCTGACTTTGGGGTCCCCCAGCCCTAGAGGAACGGGCATCTCGG
	CTGGGGGAGCCCCGGACATGGTGTGACGGGGCGGGCGGCGTGGCTGCGCCCCCCACTGCGGCCACGCACGGTCCCCGCGCCTTCCGGCATGTAGCTGCTG
	TTCTCGCTCCCCCCGGCCTCCAGCCGCAGTCTCCACGACCTCCGGCCTCCAGGCGCCAACTCTTTGTCCCCCCAGGATCCCGCCGCGGTCCTCAGGATTG
	CAGCCGCCGTCTCTTCGTCCTCCGAATTCCAGTTTCACCTGCCTTCGCGCCCCTGGGACACCAGCCGCTGTCCCTGCCACCTCCCCAGGATCCAGCCAGC
	GCTCTAGCTCACCTGCACCTCCCCAACCCACCCTGCAGCC
Exon1c 63156445 - 63155847
	GTCGTCTCCGCTCTCCGGGCCAGTCTAGACTGCAGCCGGTGACTCCGCGTCTACCCCAAACCCAGACTCCAGCCGTGACCTCCGCGCCCCGGGGAATCCA
	GCTGTCGCGCCTCTGGCCGCAGGTGCAGCTgccgccccgcgccgcgcgccccgagtgcggccgggcctcggcggggAGATGAACGCACAGCTGGACGGCC
	TGTCGGTGAGCTCGTCCTCCACCGGCTCGCTGGGCTcggcggcggcggcggcgggcggcggcgggggcgCGGGGTTGCGGCTGCTGTCTGCCAACGTGCG
	CCAGCTGCACCAAGCGCTCACGGCGCTGCTGAGCGAGCCCGAGCGGGAGCAGTTCACTCACTGCCTCAACGCGTACCACGCGCGCCGCAACGTCTTCGAC
	CTGGTGCGCACCCTGCGCGTCCTGCTGGACAGCCCGGTCAAGCGGCGTCTGCTGCCCATGCTGCGTCTGGTCATCCCGCGCTCCGACCAGCTGCTCTTCG
	ACCAGTACACGGCCGAGGGCCTCTACCTGCCAGCCACCACCCCCTACAGGCAGCCCGCCTGGGCCGCTCCCGACGGCGCGGGGCCCGGGGAGGTGCGAC
Exon1d 63155846 - 63155647
	TCGTGAGCCTGCGGCGCGCCAAGGCCCACGAGGGCTTGGGCTTCAGCATCCGCGGGGGCTCGGAACACGGCGTGGGCATCTACGTGTCTCTAGTGGAGCC
	GGGCTCCCTGGCAGAGAAGGAAGGGTTGCGGGTCGGGGACCAGATTCTGCGCGTCAACGATAAATCTCTAGCCCGGGTGACCCACGCGGAGGCTGTCAAG
Exon2 63154634 - 63154571
	GAAACTCCTAGGCAGCAAAAGTCCTGGGCTGCTTGCTGTGTGGTGTTCAGTGGCTCGTGGCCAG
Exon3 63133902 - 63133684
	GCTCTCAAAGGCTCCAAGAAGCTGGTGCTGTCTGTATACTCAGCTGGGCGTATCCCAGGGGGCTATGTGACCAACCACATCTACACCTGGGTGGACCCAC
	AGGGTCGAAGCACATCCCCTCCCTCCAGCCTGCCCCAGCCCCATGGCAGCACCCTGAGACAGCGTGAAGATGACCGAAGGAGTACCCTCCACCTCCTGCA
	GAGTGGAGATGAGAAAAAG
Exon4 63122441 - 63122316
	GTGAACCTGGTGTTGGGGGACGGCCGGTCCTTGGGCCTCACGATCCGAGGTGGAGCAGAGTACGGCCTTGGCATTTACATCACTGGTGTGGACCCAGGCT
	CTGAAGCAGAGAGCAGCGGCCTCAAG
Exon5 63121501 - 63121197
	tgaccttgcaaggaggccccagaaagccaacagaataagaagatgctatctgtgacccagcaagaaggtctcacacgcacagaacccactggtgttttgc
	ttttgagttgcccagctctagaactgtcagcaataacctgtacataagccatcatcctgtctgtggaacttcatCTgtcaacattacattatggagaagg
	gatcacaagactccgccccagccctccccaaggatttataggcagctaatgTTTTGATGCAACTACTGTCTAAATTGTATATGTAAATAAATCTTTACTC
	CTGCA
Exon6 63097635 - 63097263
	GTCTGAGGCGTCAACATCACCAAAAACACCTCCCACTCCGCACAGCCAGCTCCAGCCGTGGGGCCATGGGAGAGTCTGTCCTCCATTGTTGATACTGTGG
	ACTCAGAAGGAGGGAAACACACACAGCTGGGAAGAGGTAGCAGGGCGGAGGCAGCTGCCCTCCAGGTTACAGCAGGCATGGTGTTGTCCTATCCGTGGGC
	TCGAGAACCTGCTGGGAGAGAAAGTCCACTGAGTTCTCACTCTTCCAGGTGGTCCACTGCCCCTCTCTACACAGCAACATCTTCCTCCCGCCTCTTCTGG
	CGTTGTCTTTTCATTTTAAACATGCTCATTTGCCCATTGTTTTCTATTACAAAATAAAACTGCTGTCGTAAGA
Exon7 63096596 - 63096394
	GTTGGAGACCAGATTCTGGAGGTGAATGGGCGGAGCTTTCTCAACATCCTGCATGATGAGGCAGTGAAGCTGCTCAAGTCATCCCGGCACCTCATCCTGA
	CGGTGAAGGACGTCGGAAGGCTGCCCCACGCACGTACCACCGTGGACCAGACCAAGTGGATCGCCAGTTCCCGGATCGGGGAAAGCGTCGCCAACTCAGC
	AGG
Exon8 63095180 - 63095144
	GTTTCCAGGGGACCACACAGAAGAAGGGACAAGCAAG
Exon9a 63094356 - 63093912
	GTAGGAGATGCGAGCACTTTGTACGCAAACAGAAAGTCTGTGTCTCTGAGACAATTTTCGATATTCTTGGCAAGATGACAGGGTGGGCCAGGGAATCTGA
	AGAGAGACTGGGTGATATCAGCTGGTCAGTGGTGAGGACACCGGTATAATTTGGCACAAGTTAGGGGTACAGATCTGAACTGTAATTTAGAAATGCAGGG
	ACTCTTATCACACCAGCTTACTAAGAGAGATATCAAAACCCAGAGAATCACAGTGTGTGAATGGATGGGCTAAAGGATACACAAGAGACAAATATGAAAG
	TGCCACGGAGATGACCACATGGTGCCATCGTCCCAGGGTTAGGTGGAGCGGTTCCTGTGTGTGTGGAGACCATCAACACAACGCTAGAAGCCACAGCCTC
	CCCCGCAGCCTAGACTCCTCTGGCCTGTGTCCTTCTGTTTTTCAG
Exon9b 63093911 - 63093699
	CCAGGATTTTACAAGGGCCCAGCCGGCTCCCAGGTGACCCTGAGCAGCCTGGGGAATCAGACTCGTGCACTGCTGGACGACCAAGCCAGGCACCTGCTGA
	CAGAGCAGGAGCGCGCCACCATGATGTACTACCTGGCCCAGTACCGTGGTGGCACCATCTCTGTGGAGGCCATGGTCATGGCACTGTTTGAGTTGCTCAA
	CACACACGCCAAG
Exon10 63093093 - 63092884
	TTCTCACTCCTGTCTGAGGTGAGAAGCATCATCTCACCCCAAGACCTGGACCGCTTTGACCACCTGGTGCTGAGGCGCGAGATCGAGTCTATGAAGGCGA
	GGCAGCCCCCCGGCCCCGGGGTTGGAGACACGTATTCCATGGTTTCCTACAGCGACACAGGCTCATCCACAGGCAGCCACGGCACCTCTACAACCGTCAG
	CTCGGCCAGG
Exon11a 63090451 - 63090267
	gtgtgaccttggacagactgctcccttccagcctgcctttccatctgtgaatggaaatgctggcaccaaacctgccCCAAGTTGCTGACCTATGGAGACC
	CCCAGCCCCAAGGATAAAGCTGGCTCCTCGGAGCAGCAAGGCCTCCCAGCTTCTCCTGAGGACCCTGCTGTTCCCCTCAATAGGT
Retained Intron 63090266 - 63090153
	GTTTGTGTGGGGGTCAGGGGGGAGGGGGCGCTATGCTGAGGTGAGGCCTCTTGATTCCCTAACATTTATTTCATGTATTTTTCTTTTTGCCTTTTGCCCA
	TTCACCCTCCCTAG
Exon12 63090152 - 63090120
	GAGCGGCTGCTGTGGCTTATAGACCTGATGGAG
Exon13 63087069 - 63086627
	ATTTCTCTGCCTGGATTGAAACACCCCTCGCATGTTTGGAGTGGGGTCCTGTGGCTGCTGAGGGTGTTAGGATGGCACCCCACCTTAAAGGCCACTCTGT
	ACTCTTCCTTCCCACAGGGAAGCAAAAGAGAGGCTCCCAGCATTGTTGCAGCAGTTCTTCCGTGGCCTGAGCCTCCCTTCCCATTGTGGCAGTGAAAGAG
	TGAGACTCAAATCCCTCAGGATTGAGTGACAGCTGCTCCTCATTCAGAGACAGGGCTCAAGGAAGCAGGGCTGGCTCCCTCTACTCAGGAATGACCTGCT
	GGGTTTAAAGACTCCTTCAGAAGGAACCCCGTTCGTTCACTCGTTTGTTCAGCCTGTCCTTGCCGTGCATGCAGTGTAGGCTCTCCCACCTGGAGCTCAC
	AAGCACAATGGAGGAAGATTTTGATTTAAAAAAAAAACAAAAA
Exon14 63080527 - 63080456
	AATACATTAGACCTGGAAGGAACCGGTGAGACCACCCAGGGCAGCACCAACGCTCTCCCGGATGTGTCTGTG
Exon15 63079656 - 63079122
	GATGATGTCAAATCCCCCTCAGAAGATCTGCCTGGTATCAAGCCACCTCCTCCCCCACCACCCCTGGCTCAAGGTCATGACCGCTTGCTTGGCCAGCCAC
	GGAAGCCAGGGAGGGAGGACCCCGCACCTCTGTCTTCTGCTGCCCACTCAGGCATTGTCTTCTCAGCACCACGGAACCGCAGCCCGCCGCCAGGGACTGC
	TCCCACTCCGGGACCTTCCTCAGCACAGGACTCTCCCTCCTCCCCCATTTATGCCTCCATCTCCCATGCCAACCCCAGTTCCAGAAAGCCGCTGGACACC
	CACCTGGCCCTGGTTAACCAGCACCCCATCGGCCCCTTCCCTCGAGTCCAGTCCCCACCTCACCTGAAGAGCCCTCCTGCAGAGACCCCAGGAGCTGGGG
	CCTGCCTTCCACCACCATCACCCTCTGAACACCCTGACGCCGTGGGTGCAAACCAGCACTTTGTTCTGGTGGAGGTGCACCGTCCGGACAGTGAGCCTGA
	TGTGAATGAAGTGCGGGCTCTGCCCCAGACTCGCA
Exon16 63077627 - 63077446
	CAGCCTCCACACTCTCTCAGCTCTCAGACAGTGGGCAGACCCTGAGCGAGGACAGTGGCGTGGATGCCGGGGAGACGGAGGCCAGCACCTCAGGCCGAGG
	CAGACAGACAGCATCCGCTAAGAACAAGAATGGCAAGGAGCAGCCCCGGACGGAGAGGACCGCGGAGGGTGCCAACAAACCT
Exon17 63077158 - 63077036
	CCCGGCCTGCTGGAGCCAACGTCCACCCTGGTCCGTGTGAGGAAAAGTGCAGCCACACTGGGCATCGCCATTGAGGGCGGTGCCAACACACGCCAGCCTC
	TGCCCAGGATCGTCACAATTCAG
Exon18 63076700 - 63075944
	CGAGGAGGTTCTGCCCATAACTGTGGACAGCTCAAGGTGGGCCACGTAATTCTGGAAGTGAATGGGCAGACACTTCGGGGTAAGGAGCACAAGGAGGCCG
	CCCGAATCATCGCTGAGGCCTTCAAGACCAAGGAGAGAGACTACATCGACTTTCTGGTCACTGAGTTCAACGTGATGCTCTAGGGGTGGGGCCAAGTTCA
	GGGCTATCAGCCGGGGTCACAGGCAGAGTCTCCCACCCCACCCTGACACATACACCCTGCCTGGGCCCTTGGCCCAGACTAGGAGAAGAAGAGGGCCAGA
	CAAGGCAAGCAGAAAGTCAGGTTAAAACCTGTGTGCCAGAAACACAGTAGGGGCTCAATAAAACTATGTTAGGTGAAGGGAAGGAAGGCAGAGTACATTT
	CTCTAGGCTGGAGAGGGGTACTGCCACCCCAGATGCCTAGGCCTTTGGCTGTGAGGACACAGGAGAGTTCACACAGACTGCTTCCTGCCAGGAGGACCTT
	CAGTGCCACAAATGAGCCGCCAGCACGCTTGTTCACACCAGTCGCACCCCCTTCCTCCTGGCTCCGTGCCCCTATGGtatttatttatttatttatttCC
	CTTCCTGTGCTTCAGGGGAGCCCCCCCCCCAAAGGCCCCAGCTTCCCTTTGCACTCCCAGCCTATCCCAGAGGCCTTGCAGGCGACCAGCAATGTCAGTG
	TATTTATATACAGAGCTTATGACTTTAATTTTTCAATAAATAAATCTGAACAAGGTT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1a1d-1dbEST_BB872069.1,
23+1ENSMUST00000124016,
1d3+24dbEST_BB872069.1,dbEST_BI732824.1,dbEST_CA321445.1,dbEST_CB209310.1,REF_NM_001008791.1,REF_NM_001008792.1,REF_NM_001008793.1,REF_NM_028640.1,GB_AY739114.1,GB_AY739115.1,GB_AY739116.1,GB_AY739117.1,GB_AK122523.1,GB_BC150757.1,GB_AK157955.1,
34+26dbEST_BI732824.1,dbEST_BM940881.1,dbEST_CA321445.1,dbEST_CB209310.1,REF_NM_001008791.1,REF_NM_001008792.1,REF_NM_001008793.1,REF_NM_028640.1,GB_AY739114.1,GB_AY739115.1,GB_AY739116.1,GB_AY739117.1,GB_AK122523.1,GB_BC150757.1,GB_AK157955.1,
45+4dbEST_BG798811.1,dbEST_CF580247.1,dbEST_CN839875.1,ENSMUST00000133425,
46+3dbEST_BE987307.1,dbEST_BM940881.1,ENSMUST00000144965,
47+21dbEST_BI732824.1,dbEST_CA327501.1,dbEST_CA949304.1,dbEST_CX564102.1,REF_NM_001008791.1,REF_NM_001008792.1,REF_NM_001008793.1,REF_NM_028640.1,GB_AY739114.1,GB_AY739115.1,GB_AY739116.1,GB_AY739117.1,GB_AK122523.1,GB_BC150757.1,GB_AK157955.1,
78+18dbEST_AW742499.1,dbEST_BI732824.1,dbEST_CA327501.1,dbEST_CX564102.1,REF_NM_001008791.1,REF_NM_001008793.1,REF_NM_028640.1,GB_AY739114.1,GB_AY739115.1,GB_AY739117.1,GB_AK122523.1,GB_BC150757.1,GB_AK157955.1,
89b+20dbEST_AW742499.1,dbEST_BI732824.1,dbEST_CX564102.1,ENSMUST00000063650,REF_NM_001008791.1,REF_NM_001008792.1,REF_NM_001008793.1,REF_NM_028640.1,GB_AY739114.1,GB_AY739115.1,GB_AY739116.1,GB_AY739117.1,GB_AK122523.1,GB_BC150757.1,GB_AK157955.1,
1b9b+6ENSMUST00000095038,ENSMUST00000119294,REF_NM_001008794.1,REF_NM_001008795.1,GB_AY739118.1,GB_AY739119.1,
1b10+3ENSMUST00000095037,REF_NM_001008796.1,GB_AY739120.1,
9b10+34dbEST_AW742499.1,dbEST_BB595145.1,dbEST_CF170657.1,dbEST_CX215188.1,REF_NM_001008797.1,REF_NM_001008798.1,REF_NM_001008791.1,REF_NM_001008792.1,REF_NM_001008793.1,REF_NM_001008794.1,REF_NM_001008795.1,REF_NM_028640.1,GB_AY739121.1,GB_AY739122.1,GB_AY739114.1,GB_AY739115.1,GB_AY739116.1,GB_AY739117.1,GB_AY739118.1,GB_AY739119.1,GB_AK122523.1,GB_BC150757.1,GB_AK157955.1,
810+1dbEST_CA327501.1,
1011a+5ENSMUST00000145133,ENSMUST00000145630,REF_NM_001008798.1,GB_AY739122.1,GB_AK190484.1,
1012+10dbEST_BY729250.1,dbEST_CX215188.1,ENSMUST00000084510,ENSMUST00000095038,REF_NM_001008791.1,REF_NM_001008794.1,GB_AY739115.1,GB_AY739118.1,GB_AK021254.1,
11a12+2ENSMUST00000145630,GB_AK190484.1,
1213+3dbEST_BY729250.1,ENSMUST00000148957,GB_AK021254.1,
1014+24dbEST_CA327501.1,dbEST_CF170657.1,ENSMUST00000063650,ENSMUST00000102867,REF_NM_001008797.1,REF_NM_001008792.1,REF_NM_001008793.1,REF_NM_001008795.1,REF_NM_001008796.1,REF_NM_028640.1,GB_AY739121.1,GB_AY739114.1,GB_AY739116.1,GB_AY739117.1,GB_AY739119.1,GB_AY739120.1,GB_AK122523.1,GB_BC150757.1,
1214+11dbEST_CX215188.1,ENSMUST00000084510,ENSMUST00000095038,ENSMUST00000145133,REF_NM_001008798.1,REF_NM_001008791.1,REF_NM_001008794.1,GB_AY739122.1,GB_AY739115.1,GB_AY739118.1,GB_AK190484.1,
1415+35dbEST_CA327501.1,dbEST_CF170657.1,dbEST_CX215188.1,ENSMUST00000063650,REF_NM_001008797.1,REF_NM_001008798.1,REF_NM_001008791.1,REF_NM_001008792.1,REF_NM_001008793.1,REF_NM_001008794.1,REF_NM_001008795.1,REF_NM_001008796.1,REF_NM_028640.1,GB_AY739121.1,GB_AY739122.1,GB_AY739114.1,GB_AY739115.1,GB_AY739116.1,GB_AY739117.1,GB_AY739118.1,GB_AY739119.1,GB_AY739120.1,GB_AK122523.1,GB_BC150757.1,
1516+31dbEST_BQ177739.1,dbEST_CA528127.1,dbEST_CF736103.1,dbEST_CX244045.1,REF_NM_001008797.1,REF_NM_001008798.1,REF_NM_001008791.1,REF_NM_001008792.1,REF_NM_001008794.1,REF_NM_001008795.1,REF_NM_001008796.1,REF_NM_028640.1,GB_AY739121.1,GB_AY739122.1,GB_AY739114.1,GB_AY739115.1,GB_AY739116.1,GB_AY739118.1,GB_AY739119.1,GB_AY739120.1,GB_BC150757.1,
1617+39dbEST_BF300524.1,dbEST_BI733972.1,dbEST_BQ177739.1,dbEST_CA528127.1,REF_NM_001008797.1,REF_NM_001008798.1,REF_NM_001008791.1,REF_NM_001008792.1,REF_NM_001008793.1,REF_NM_001008794.1,REF_NM_001008795.1,REF_NM_001008796.1,REF_NM_028640.1,GB_AY739121.1,GB_AY739122.1,GB_AY739114.1,GB_AY739115.1,GB_AY739116.1,GB_AY739117.1,GB_AY739118.1,GB_AY739119.1,GB_AY739120.1,GB_AK122523.1,GB_BC150757.1,
1718+41dbEST_BF300524.1,dbEST_BI733972.1,dbEST_BQ177739.1,dbEST_BY704353.1,REF_NM_001008797.1,REF_NM_001008798.1,REF_NM_001008791.1,REF_NM_001008792.1,REF_NM_001008793.1,REF_NM_001008794.1,REF_NM_001008795.1,REF_NM_001008796.1,REF_NM_028640.1,GB_AY739121.1,GB_AY739122.1,GB_AY739114.1,GB_AY739115.1,GB_AY739116.1,GB_AY739117.1,GB_AY739118.1,GB_AY739119.1,GB_AY739120.1,GB_AK004110.1,GB_AK122523.1,GB_BC150757.1,