NIA Mouse Gene Index (mm92)

Exon structure for U025670

chr4 -

Exon1 136158638 - 136158147
	GGGCGCGTGCGCACGCGGGGGTGTTTGGCTTCGCACGGAGCGTGAGAGGTGCGGGGCGGAGAGGCGCGAGGCGGCTGCGGACCCACGGAGCGGCAGACCG
	ATCGGCCCCTGCGGCCCGCGGCGGCCAGGCGGCCCGAGATGTTGTCTGGGAAGAAggcggcggcggcggcagcggcagcggcggcggcggcggcTGCTGG
	GACCGAGGCCGGGTCCGGGGCGGCGGGCGGTGCCGAGAACGGCTCTGAGGTGGCCGCGCCGCCCGCGGGCCTGACGGGCCCCACCGACATGGCTACGGGG
	GCGGCGGGCGAGCGCACTCCCCGAAAGAAGGAGCCTCCGCGGGCCTCGCCGCCCGGGGGCCTAGCCGAGCCGCCGGGGTCTGCTGGGCCCCAGGCGGGGC
	CCACAGCCGGGCCCGGCTCCGCGACGCCCATGGAGACCGGAATAGCCGAGACCCCGGAGGGCCGACGGACCAGCCGGCGCAAGCGGGCCAAG
Exon2 136149045 - 136148880
	GTAGAATACAGAGAAATGGATGAAAGCTTGGCCAACCTCTCAGAAGATGAATATTATTCGGAAGAAGAAAGAAATGCTAAAGCAGAGAAGGAAAAGAAGC
	TTCCCCCACCACCTCCTCAAGCCCCACCTGAGGAAGAAAATGAAAGTGAGCCGGAAGAGCCGTCTG
Exon3 136138014 - 136137955
	GGCAAGCAGGAGGACTTCAAGACGACAGTTCTGGAGGGTATGGAGACGGCCAAGCATCAG
Exon4 136133119 - 136132986
	GTGTGGAGGGTGCAGCTTTTCAAAGCCGACTTCCCCATGACCGAATGACCTCTCAGGAAGCAGCCTGTTTCCCAGACATCATCAGTGGGCCTCAGCAGAC
	ACAGAAGGTTTTTCTGTTCATCAGGAATCGCACA
Exon5 136130018 - 136129940
	TTGCAGTTATGGCTGGACAACCCAAAGATCCAGCTGACGTTTGAAGCCACTCTCCAGCAGCTGGAAGCGCCTTACAACA
Exon6 136129080 - 136128988
	GCGATACTGTGCTTGTCCACCGAGTTCACAGTTACTTAGAGCGCCATGGTCTTATCAACTTCGGCATCTACAAGAGGATAAAACCCTTACCAA
Exon7 136128239 - 136128133
	TTAAAAAGACAGGAAAGGTGATTATTATAGGTTCAGGTGTTTCTGGCTTGGCAGCAGCTCGACAGCTACAGAGTTTTGGGATGGATGTCACACTTCTGGA
	AGCCAGG
Exon8 136126454 - 136126373
	GATCGAGTAGGTGGACGAGTTGCTACATTTCGAAAAGGAAACTATGTAGCTGATCTTGGCGCCATGGTTGTAACAGGTCTTG
Exon9 136124582 - 136124488
	GAGGGAATCCCATGGCTGTCGTCAGCAAACAAGTAAATATGGAACTGGCCAAGATCAAGCAAAAATGCCCACTTTATGAAGCCAATGGACAAGCT
Exon10 136119364 - 136119353
	GACACTGTCAAG
Exon11 136117075 - 136116933
	GTTCCAAAAGAAAAAGATGAAATGGTAGAACAAGAATTTAACCGGTTGCTAGAAGCCACTTCTTACCTTAGTCACCAGTTAGACTTCAACGTCCTCAATA
	ATAAACCTGTATCCCTTGGCCAGGCATTGGAGGTTGTCATTCA
Exon12 136116328 - 136116238
	GCTGCAAGAAAAGCATGTCAAAGATGAGCAGATTGAACATTGGAAGAAGATAGTGAAAACTCAGGAGGAGTTGAAAGAGCTTCTTAATAAG
Exon13 136115222 - 136115088
	ATGGTAAATTTGAAGGAGAAAATTAAAGAGCTCCATCAGCAATACAAAGAAGCTTCAGAAGTGAAGCCGCCCAGAGATATCACAGCCGAGTTCCTGGTGA
	AGAGCAAGCACAGGGACCTGACTGCCCTCTGCAAG
Exon14 136114486 - 136114413
	GAATATGATGAATTAGCTGAAACACAAGGAAAGCTAGAAGAAAAACTTCAAGAATTGGAAGCCAATCCCCCAAG
Exon15 136113668 - 136113557
	TGATGTATACCTCTCATCAAGAGACAGACAAATACTTGACTGGCATTTTGCAAATCTTGAATTTGCCAACGCCACACCTCTCTCTACCCTCTCTCTTAAA
	CATTGGGATCAG
Exon16 136113358 - 136113269
	GATATAGAGCATTTTACcctggtgtcaccgtgcactcctgtcatcccagtgctttggaggctaggacagaaaaaaattaatgagttcaag
Exon17 136111220 - 136111088
	GATGATGACTTTGAGTTTACTGGAAGCCACCTGACAGTAAGGAATGGCTACTCATGTGTGCCTGTGGCTTTAGCTGAAGGCTTGGACATTAAACTGAACA
	CAGCAGTGCGGCAGGTTCGCTACACAGCCTCAG
Exon18 136110315 - 136110128
	GATGTGAAGTGATTGCTGTGAACACACGTTCCACAAGTCAAACCTTTATTTATAAGTGTGATGCAGTTCTCTGTACACTTCCTTTGGGAGTGTTGAAGCA
	GCAGCCACCAGCTGTTCAGTTTGTGCCACCTCTTCCTGAGTGGAAAACATCTGCAGTCCAAAGGATGGGATTTGGCAACCTTAACAAG
Exon19 136109825 - 136109711
	GTGGTGTTATGCTTTGACCGTGTGTTCTGGGACCCAAGTGTCAATTTGTTTGGGCACGTTGGCAGTACAACTGCTAGCAGGGGTGAGCTCTTCCTCTTCT
	GGAACCTATATAAAG
Exon20 136108503 - 136108376
	CTCCAATACTATTGGCCCTGGTAGCAGGAGAAGCTGCTGGCATTATGGAGAACATTAGTGATGATGTGATTGTCGGCCGGTGCCTGGCCATTCTCAAAGG
	GATTTTTGGCAGCAGTGCAGTCCCACAG
Exon21 136107933 - 136107787
	CCCAAGGAAACTGTGGTATCTCGTTGGCGTGCTGATCCGTGGGCCCGGGGCTCCTATTCTTATGTGGCTGCAGGATCCTCTGGAAATGACTATGATTTAA
	TGGCTCAGCCGATCACTCCTGGCCCCTCAATTCCAGGTGCCCCACAG
Exon22 136106948 - 136106448
	CCAATCCCAAGACTCTTCTTTGCTGGAGAACACACAATCCGGAACTACCCAGCTACAGTCCATGGTGCTCTGTTGAGTGGGCTTCGAGAAGCAGGAAGGA
	TTGCCGACCAGTTTTTGGGAGCCATGTACACTTTGCCTCGTCAGGCCACACCAGGTGTCCCTGCACAGCAGTCCCCAAGTATGTGAGACAGATGGTTCTG
	AACAGAGAGATCCAACGGCATGTCATCTGCCACGTAAGCAAGCTCTTCTAGCAATACTAGATCCTACTGAGAAACTCCATGTCATCAGCTACTGGGACTC
	CTAGTTTGACAGCAGAGGCTGGCTCCTTTGGCTGACAGCAACTTACCCATTGATTTGGAAGTACAGCTCCATAAAGACTGCTCGAGAAGCAAGTGGTGTG
	AGATAACCTCTTAGTCTATGGTGTTTGTTTGTTTTTGtttttttttaatatattttgagaataaaactttaaaataattttatatGAAAAtttattttta
	a

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+19dbEST_BG078465.2,dbEST_BI077967.1,dbEST_BU708355.1,dbEST_BY032767.1,REF_NM_133872.2,GB_AK129170.1,GB_BC059885.1,
23+18dbEST_AA183440.1,dbEST_AV572263.1,dbEST_BG078465.2,dbEST_BI694450.1,
24+8dbEST_BI077967.1,dbEST_BP765036.1,dbEST_CA315698.1,ENSMUST00000116273,REF_NM_133872.2,GB_AK129170.1,GB_BC059885.1,
34+18dbEST_AA183440.1,dbEST_AV572263.1,dbEST_BG078465.2,dbEST_BI694450.1,
45+34dbEST_AA183440.1,dbEST_AI286601.1,dbEST_BG078465.2,dbEST_BI694450.1,REF_NM_133872.2,GB_AK129170.1,GB_BC059885.1,
56+35dbEST_AA183440.1,dbEST_AI286601.1,dbEST_BG078465.2,dbEST_BI694450.1,REF_NM_133872.2,GB_AK129170.1,GB_BC059885.1,
67+43dbEST_AA183440.1,dbEST_AI286601.1,dbEST_BM949344.1,dbEST_BP765036.1,REF_NM_133872.2,GB_AK129170.1,GB_BC059885.1,
78+53dbEST_AA183440.1,dbEST_AI286601.1,dbEST_BI794081.1,dbEST_BM949344.1,REF_NM_133872.2,GB_AK129170.1,GB_BC059885.1,
89+47dbEST_BI466654.1,dbEST_BI794081.1,dbEST_BI694450.1,dbEST_BM949344.1,REF_NM_133872.2,GB_AK129170.1,GB_BC059885.1,
910+7dbEST_AL362962.1,dbEST_BM949344.1,dbEST_BQ443150.1,dbEST_BU702635.1,
1011+7dbEST_AL362962.1,dbEST_BM949344.1,dbEST_BQ443150.1,dbEST_BU702635.1,
911+51dbEST_AA591715.1,dbEST_AA591334.1,dbEST_AI037578.1,dbEST_BF731013.1,REF_NM_133872.2,GB_AK129170.1,GB_BC059885.1,
1112+54dbEST_AL362962.1,dbEST_BF451654.1,dbEST_BF731013.1,dbEST_BI466654.1,REF_NM_133872.2,GB_AK129170.1,GB_BC059885.1,
1213+52dbEST_AA895032.1,dbEST_AL362962.1,dbEST_AV581936.1,dbEST_AW822875.1,REF_NM_133872.2,GB_AK129170.1,GB_BC059885.1,
913+1ENSMUST00000046846,
1314+55dbEST_AA463031.1,dbEST_AA473827.1,dbEST_AA546210.1,dbEST_AA145717.1,REF_NM_133872.2,GB_AK129170.1,GB_BC059885.1,
1415+47dbEST_AA463031.1,dbEST_AA473827.1,dbEST_AA546210.1,dbEST_AA145717.1,REF_NM_133872.2,GB_AK129170.1,GB_BC059885.1,
1516+2dbEST_CB248387.1,ENSMUST00000155354,
1617+2dbEST_CB248387.1,ENSMUST00000155354,
1517+38dbEST_AA119821.1,dbEST_AA463031.1,dbEST_AA473827.1,dbEST_AA546210.1,REF_NM_133872.2,GB_AK129170.1,GB_BC059885.1,
1718+33dbEST_AA119821.1,dbEST_AA463031.1,dbEST_AA473827.1,dbEST_AW822875.1,REF_NM_133872.2,GB_AK007763.1,GB_AK129170.1,GB_BC059885.1,
1819+44dbEST_AA220493.1,dbEST_AA414792.1,dbEST_AA008061.1,dbEST_AA881881.1,REF_NM_133872.2,GB_AK007763.1,GB_BC019417.1,GB_AK129170.1,GB_BC059885.1,
1920+42dbEST_AA798441.1,dbEST_AA982891.1,dbEST_AA220493.1,dbEST_AA414792.1,REF_NM_133872.2,GB_AK007763.1,GB_BC019417.1,GB_AK129170.1,GB_BC059885.1,
2021+59dbEST_AA277251.1,dbEST_AA060855.1,dbEST_AA240785.1,dbEST_AA218369.1,REF_NM_133872.2,GB_AK007763.1,GB_BC019417.1,GB_AK129170.1,GB_BC059885.1,
2122+60dbEST_AA277251.1,dbEST_AA980634.1,dbEST_AA060855.1,dbEST_AA240785.1,REF_NM_133872.2,GB_AK007763.1,GB_BC019417.1,GB_AK129170.1,GB_BC059885.1,