NIA Mouse Gene Index (mm92)

Exon structure for U025676

chr4 -

Exon1 136604716 - 136604561
	GGCCCTCGGCGTTTTCCCCGGCCCCAAGATGGCTGCCTTTTGGCGTCTCCAGCGCTGTTGAATGGAGAAAGCTTTATTGTTCCCTTCGGGCAGGAGTGTT
	CGTGTCCTCAATGGCGCTGTCAATAAAGAACGGCAGTTTGAATCGGTGCTGAGCAG
Exon2 136591797 - 136591755
	AGCCTTCTGAGTGGCAGATTGTAGGTGTGCACCACCAcatctg
Exon3 136574682 - 136573939
	GTGGAGTCTGAAGGGCTAGAGGAAGGCGGCAAGGGCAGAGCCACAGCATGGAACTCCCCAGCTACAGCCAGCAGCTGCTTCTGCAGCTCTACGCCCTGTG
	CAAGGAGCAGCGGTTCTGTGATTGCACCATTTCCGTCGGCAACATCTACTTCAGGGCCCACAAGCCAGTCCTGGCAGCAGCCAGCCTCCTGTTCAAAACC
	CTGCTGGACAGCACAGACGCCATCTCCATCGATGCATCCGTGGTGAGCCCCGAAGAGTTTGCCCTCTTGCTAGAAATGACATACACCGGTAAGCTACCTG
	TGGGCAAGCACAACTTCTCCAAGATCATCTCCTTAGCAGATAGCCTGCAGATGTTTGACGTGGCCGTTAGTTGTAAAAACCTTCTGACCAACCTGGTAAA
	CTGCTCTGTCCAGGGGCAGGTGGTAAGAGATGTCTCAGTGCTGTCCTCAGAGGCAGGGAACAAGGAGTCAGAGAAGCCACAAGTAGAAGCCCTCTCCTCT
	GAAGGTGCTGAGGAGCCCTCTTCTTCCCCGGAAGTTTCTGCCGTGCCAGCGGGCCCTGAGAAAGCCAAGACCCAGGACGTAATCAACATAGCTACCCAAG
	AGATAAATGCAGACCCTCCCGTTGCCCAAGAGGTTCAGGTGGCTGCAGAGATCACAGGGGCGACTCCTCACACAGCTGAAGTTTGTTCCCCTTCCCCTGT
	TGGACAAATCCCAAGTGAGACGAAAGAAGTCAATACAGAAGCAG
Exon4 136573325 - 136573192
	AGTGCGAGACAAAGCAGGACCAACTGACTCTCCTGCTAGAGCATGAAAGCGTCTTCTCAGATGCAGCCTTGCTCACCCCAGACACCCTGAGAAGACTGGC
	AGGATGCTCAGAGATTGAAGGGCCTCAGAAGGAG
Exon5 136563812 - 136563650
	ACCATAATAGAATGTCTCACGAGTGAAGGAGGCAGTTCAGCGTTCCAGAGAATTCTGGACAAAGTGCACGATGGGAGCCTGGATGTGCAGGTGGCTCTGT
	CTCTGGTGAGACTATACCAGGAGTCTACACCTGCAGAGAAAGTGTCTCAGATTCAACCAGAAG
Exon6 136563095 - 136562953
	GGAGCGCAGGAGAGGGAAAGACCTTGTCTGTTCTGCTACTGGAACACAAAGAGGACCTGATCCAGTGTGTAACACAGCTCAGACCTATTGTGGAGTTCCT
	GGAAACAGCCAAGGAGGAATTCCTGCCAGATTCCGAAAAAAGG
Exon7 136557308 - 136557116
	GTGATTCAGAGCTGCTGTGAGGGCAGAACACCCAAGGAGATGATAGAGAATTTGTTGCACAGAGTGACTGAAGAGAAGACCCTGCCTGCCAAGAGTCTGG
	TAAAACTCCTCCAGGCTGTGAGGACAGCATTCCCAAACCTGGACCTCCTGCTGGACAATTTGCAGAAAGGAGCGGGATCAGCCGGCACCACAG
Exon8 136556889 - 136556809
	GCCTGGCCAGAGTCTCCTGTGAATCAGAATGGACAGATGAGCCCAGGCCAGTGTGCATTCCAGCAGACCGCGTGGATGGAT
Exon9 136555842 - 136555717
	GGCATTATGAAGAACACAGTCTGTACACCAGAGCCGCTTACAAATGCAGCGTCCTCATTACCCGCCTGCTGGGCAGTCACTGCCTTCTCCCAGCCACTAG
	CCTGTTTGTACGACCCTGAAGCTCTG
Exon10 136555527 - 136555391
	CCTCCCCTAGCCCTGATGCTTACGGAGCTGAGCTGTTGAGAAAGTACCATGAGAACCTGTCTGAGATTCTCATAGACAACCAGGTGCTGCTGAAGGTGAT
	CTCACGGATGCAAAGCTTAGCCCCTGGAGACAGAGAG
Exon11 136554613 - 136554412
	GTCATGCAGACCCTCGTGAAACAGGGCTCTGGCTCGGGTGGCTTCAGTTCCCTGATGTTGGCAGCTCTGGAAAGGCAGACTCTCTCAGCAACGGCCATTT
	GGCAACTACTGCTAGCAGTTGAAGAGACTGAGACCCGCCCACTGAACCTGCTCTTGGAGGAAGTAGGAAAGGAGCCCGGCGCTGGGGCTTTCTTCCGGGC
	AG
Exon12 136553869 - 136553736
	TGACTGCCCCAGAGAGCACAGTATTGGAAGCCATCCTGAGGCACAGCAAGCTGCTCCGGGAAGCCATCCAGCAGACAGCGGGGTGTGAGCGCCTTTCTTC
	AGAGGAAGAACACCTGGCAGAGACCGTGCAAGAG
Exon13 136552108 - 136551940
	ATGCTGAGCATATCCTCCGAGACAGTGAGCCCTGAAGCCTCCCTGAGAGCGGTGCTGAGCAAAGCCATGGAGAAATCTGTCTCGGCCTCTGTGGTCTGTC
	ACCTCCTCTGCAGTGTCCACAAGTCTTTCCCTGGCCTGCAGCCCCTGATGCAGGAGTTGGCACATGTTG
Exon14 136551627 - 136551166
	GTTTCCTTACCAAGGAAAGCGGAGAGGAGAGGTGGAAGGTGACTGATGGCCTTCACCCTGGAGCCAAGGACAAAGTGGAGGAAGTGGCCAAGGCAACCGG
	AGAAGACTGCCAGGCCAATGAACAAAAGGAGCAGGGAGAGCCTGGGCCCGTGCCAGAGCAACCGGAGAAAGACACTTCTGCCTCCCCAGACTCTGCCAAG
	AAGAGCTTCGTCTGCAAAGCCTGTGATAAGAGCTTCCATTTCTACTGCCGTCTGAAGGTGCACATGAAGCGCTGCCGGGTGGCCAAGAGCAGGCAGGTGC
	AGAGCGAGGAGGGCAGCGAGACCAAGGGCTCGGAGAAGGGGCTGGAGAAGCAGCAGCCGGACGCCCGCGGCACAGGTGGGGAGCCCGATGCCCCCAAGAA
	GAAGAAGAAGCGGCTGCCAGTGACATGTGACCTCTGCGGAAGAGAGTTTGCCCATGCCTCAG
Exon15 136550466 - 136550260
	GCATGCAGTACCACAAGCTGACCGAGCACTTCGACGAGAAACCTTTCTCCTGTGAGGAATGTGGGGCGAAGTTTGCAGCCAACTCTACCCTGAAGAACCA
	CCTGCGCCTGCACACCGGAGACCGCCCGTTCATGTGCAAGCATTGCCTCATGACCTTCACGCAGGCCTCCGCCCTGGCTTACCACACCAAGAAGAAGCAC
	TCGGAAG
Exon16 136547577 - 136547413
	GGAAAATGTACGCGTGCCAGTACTGTGACGCCGTGTTCGCCCAGTCGATCGAGCTATCCCGGCATGTGAGGACCCACACCGGGGACAAGCCATATGTCTG
	TAGGGACTGTGGAAAGGGCTTCCGGCAAGCCAACGGCCTCTCCATCCACCTGCACACCTTCCACA
Exon17 136544680 - 136544463
	CAGACATAGAAGACCCTTATGACTGCAAGAAATGCAGGATGAGCTTCTCCACACTGCAGGACCACCGGAAGCACATCCACGAGGTGCACGCCAAGGAGTA
	CCACCCCTGCCCCACGTGCGGCAAGATCTTCAGTGCCCCTTCCATGCTGGAGCGGCACATGGTGACCCACGTGGGAGGGAAGCCCTTCAGCTGTGGGATC
	TGCAACAAGGCCTACCAG
Exon18 136543286 - 136543124
	CAATTGTCTGGATTGTGGTACCACAATCGGACGCACCACCCAGATGTGTTTGCTGCTCAGAACCATCGGTCACCCAAGTTCTCATCACTGCAGTGTAGCT
	CCTGTGACAAGACCTTTTCCAATACTGTCGAACACAAGAAGCACATCAAAACAGAACACACAG
Exon19 136542484 - 136542398
	ATGTGAAGTTCCATGAGTGTGACCAGTGCAAGGAGCTCTTCCCCACACCTGCTCTGCTCCAGGTTCACGTCAAGTGCCAGCATTCAG
Exon20 136540955 - 136540729
	GGTCGCAGCCATTCCGGTGCTTGTACTGTGCAGCCACCTTCCGCTTCCCGGGAGCCCTGCAGCACCACGTCACCACAGAGCACTTTAAGCAGTCGGAAAG
	CACCTTCCCCTGCGAGCTCTGTGGCGAGCTCTTCACCTCCCAGGCCCAGCTTGATAGCCACTTGGAGTCTGAGCACCCAAAGGTGGCAGGCACTGAGTCC
	CAGGCAGCTGCCTCTCGCATGGTGCAG
Exon21 136540051 - 136540009
	CAGCCTCTGGGGAGCAGGGCAAGTGTGATGAACAGGAGTCCAG
Exon22a 136539159 - 136538201
	GTGATCCGAGCTCCGGAGCCAGCGGCCCCGGCCGAGCAGGTGATCACGTTGGAGGAGACGCAGCTCGCTGGCTCGCAGGTGTTTGTGACCTTGCCAGATT
	CACAGACCTCTCAGAACAGCTCCGAGCTTGTGGCAGTGACGGTGGAGGATTTGCTGGATGGTACTGTCACATTGATCTGTGGTGAGGCCAAGTGAGTGGC
	TTCCTTCAGTAGAGGAGCCCGTGCTGTACCAGCAAGGATGCTCTCTGCCTGCCTCTGCTCTAGCTGCTCGGCTGAGCTCCACCCTGGTGCTCTCACTTGA
	AAAACAGAGGCTTTGTCGTTCTCATAGGATCCACAGTGTCTGAGCTATCCACGCTGACACCAATACTACCGCCCTGTGTGGTGGAGCCTCAATCCTCCAG
	GCTTCAGCTCATGCCTGGACTCCACCCACCCCAGGGAAGTCTGGCTTCTGGAATCAGAGTCTGGGGGAATCAGAGTGGAGGGGAGCTGGTAGCCAGGATG
	GCCAAGGAGATACAGCATGCTGGCTGCCCTCAGGAGCAGGAGAGTTACCTGAGTCTGAGCCAGCAGAAGGCCACAGACACCGCCAGTGCCTCTGCCAGGG
	AAGCACCCACACAGCCTCTAGGGACTCCTGCGTGGCAGCCTGTCCTCCCTGGCCCCTGCTCAGGTTCCCCTTGGAGGCTGTAAGACAGGTGGCCATGTTA
	ACAGTGCAGGCATTGGCATCCCTGATCCTCCCTGCTCTGTCTTTCCCAAAACACAGCTTCAGAGCATTGCCACTGGGGGGGCAGCTTCATGTGAGGCCAT
	CCTGCTGCCTCTGCCTTGCTGGGTGTTCATTGCATTCCCATATCAGAACCTCCCTGTGAGGCTCTGGCCTGCCACACCTTCAAGCTAATCAAGGCTGAAG
	CATCCCAGCCTGGAGACCTCTTGCTGACTTCCTCTGTACCATGTGGTAGTCTAATGAAG
Exon22b 136538200 - 136535647
	CAGCTCCTGGGGGCAGGCCTGTGCCTGCATGTGACGGATTAGAGGCATCTGAGGTGGCTTCTGCTTCTCCCGTGGCCGGCCCACATGCCTGGTGCATGGC
	CTGCTCCCTGGGATCCCCCTGGCTGCATGCTTACTGCAGCGCCATGCTCCTTTCAAGTCTGAGTGTCACAGAGCCTTTTATCTTCAGTTCCTGACACACA
	GTCTGGTAATTGATGGCTCGTGGAATCCGGTTGGAAGTGCAATTAGATGGATGTTGGTTCCTACTGCTCGGAGAGAAGGGCTTGCATCTAGCTTGCTTTT
	CTAGAAGCCCAAAGAGAGGAGTGGGTTATCACAGTATTTGCCCATCAGGCCGGGCTCCCTGTCACCTGGTGTGGCTGGTTACCTACAGAGGGGATGCCCT
	GATTTGACACTCACCTTTAAGCCACCTGCTCTCAGAGATAAGCCCACACCTTCCTGCCAAGTGCAGCTCGCAGAAGCATGTGCAGAGAGGGAGGGTCTCT
	TCTGATCATGGCGGAGATGCATCGCCACCATGCCTTGGCGGGCTCACAGGGAGACAGGCGGTAGCAGCTTAAACCGCAGCAGTGTTCAAGGCCTGCTGCC
	CTTTGGCCTCAGCTTGGCACAAGACAGCACTGGTGAGTTTCTATTCCAGTGATGGCCAGCCTCTCCCAGTCAGCCCCACCCTCCTCATTGCATATGCAAA
	TCGTTTGAACTCATCAGCTAGGGAATCTCCCCTTTCTAAAAGTAAATGTTTTTCAAAGCAAGTCAGCCTCAGAAGCCAAACACTGACCAGAAGATGGTGC
	TCGAGCACCGAGACTTCGCCTCCCTGTTTCTTCACTGCGGCCCTAGCCTGCTGGCTTTCAGACCGCGCCTGCCAGCCGACCAGGGGAGCTCTCGATCTGT
	AAGTGGAGAGGTGGTTCCTCAGTCCATCGTCCAGGCTTCTGTCAGGAACAGCACCTCACAAGCTGTGGAGGACTTAGGAACTGTAGTGTCACCAACAAAG
	TCTTTTCCCAGCAAAAGGCAAACCTCACAGAGGTCCTGAGAGAGAAAGTCTCTAAATACAAAGAGCTGTAAGGTAGAAACCTGAGTGTCTGAGAAACACA
	GTCTCGTTTTCCTGGAACCTGGGTGGTGTGCTACCTACCTTCAGTCACCAGACCGTAGTTGGCTGCAGAAAGCCTTAGGGCAGGTTGGCTGGCTGCCCAT
	CCTTGGATGCCCAGCTCTGTAATGCACACTGCTGGAGGCACAGCAGTGCTGGGTCTGGAGTATGGAGAATTCCTGTCCTCAATGAGCTCTGTGCTGGTGA
	CTCGCGGCCTCTGCCCCAGCTGCCTGACTTTTTACAGTGGCTCTGAAGAAGGTGAAAAATCTCCATCTGCTGCCCCAGAGACCTGCCATGTGGGCCTCCG
	TGGTCCACATTGCTTTTGCAATGGAACTGTGGCTCCATTTGCTTCAACCTCATGAATACTACCTGCCTAGCCCGTGGGCAGGAGCTAGAGGAGCCTCCAG
	GTCCCTTGGAATTTGTGTATTTAAGCAACGGGGCCCCAGTCTTCCCTAAGGCTCCTGACCCAGCCACCAAAGAGGGGAAGGCGATGCCAAGCTGGAGTCT
	GGTTGGCCCGTCGCTGGTGTATGGACTGAGCAGGTGAGATTTGCTGTCCACATGCATGAGCAGAGCCGAGGCGAGCGTGGCAGATAAAGGTCTTTCTCAG
	CTGTTTTATCAGGATGGGCTCTACTGTCTTCTAAGCTGTGTGTCAGAAAAGCTTTGAGTTCTGTCAGCATCCAAGCCTGCTGTACTGTAAGTTCTGGGCC
	TGTGTGTTGTACTGGCCATTCTACAGAAGCCTCCAGCCCATGCTGACCACAGGAGATACCTCAGCCTTGTCCCTAGTGCCTGAGCACTGATGGTTAGGAC
	CGAGATGAGGGACAGATGCCAAATGAGGGGGAAAGATCTCTGTCGTCCTGAGGATGGAAGGGTGTGCCTTTAAATTTCTTGTGCCTGAGAACCTGTACTG
	ACAAAGGATGGAGACCCTGACGGCCCCACTTAGAGTGGGCAGTGCTTGCCAGGAACAGAAGTGTTTCTTCTGGAACTAGAAAGTTGGCCAGGGGTGGAGA
	TGGCATTGGTTTGTTCTAGTCAGCTCTCCCACCCCAGCTTTGTTCTTCCGGGTCCCGTCTGTCCCAGCAGACACTTGGAAGAAATTGAGAGTAAGAGACT
	TAGGGCTGAGGGAGTCAAAGGAGGTTCATAGTTTTGTTGCTGTGGAAACCTTGGGGCACTGAGGACTTATACTAAAACTCAGAAACTCAAACCTACTCCA
	GTCTAACTGGGCCTATAAAGAAGAGGAGAGTGTGAGTTCTTTGGGGACTGTGTTGTTGAGGAAATCGTTCCTTGAGCAATTTTACATTGCCTCCAAATTG
	TGAAGCTGGCCGCGGTTTCCCTGCCCAAGGCCGCCGCTGCTCGTTTCCACCCAGGGCCAGGACAGCCAGCCCCGTGAGATGTGAAAACTGATTGCAAACT
	AGAGCTGCTCGACATGCACTGTGGAGAGAAATAAAGTCTGTACTTAGGAAGCAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
23+2dbEST_BP758115.1,GB_AK220256.1,
13+14dbEST_BB629520.1,dbEST_BB611144.1,dbEST_BU706479.1,dbEST_CJ100389.1,REF_NM_198248.1,GB_BC059177.1,GB_AK036584.1,
34+5dbEST_CF538062.1,ENSMUST00000049583,REF_NM_198248.1,GB_BC059177.1,GB_AK220256.1,
45+6dbEST_CF538062.1,dbEST_CN535083.1,ENSMUST00000049583,REF_NM_198248.1,GB_BC059177.1,GB_AK220256.1,
56+5dbEST_CN535083.1,ENSMUST00000049583,REF_NM_198248.1,GB_BC059177.1,GB_AK220256.1,
67+6dbEST_CK638719.1,dbEST_CN535083.1,ENSMUST00000049583,REF_NM_198248.1,GB_BC059177.1,GB_AK220256.1,
78+6dbEST_CK638719.1,dbEST_CN535083.1,ENSMUST00000049583,REF_NM_198248.1,GB_BC059177.1,GB_AK220256.1,
89+1dbEST_CN535083.1,
910+1dbEST_CN535083.1,
810+5dbEST_CK638719.1,ENSMUST00000049583,REF_NM_198248.1,GB_BC059177.1,GB_AK220256.1,
1011+5dbEST_CK638719.1,ENSMUST00000049583,REF_NM_198248.1,GB_BC059177.1,GB_AK220256.1,
1112+6dbEST_CK638390.1,dbEST_CK638719.1,ENSMUST00000049583,REF_NM_198248.1,GB_BC059177.1,GB_AK220256.1,
1213+5dbEST_CK638390.1,ENSMUST00000049583,REF_NM_198248.1,GB_BC059177.1,GB_AK220256.1,
1314+5dbEST_CK638390.1,ENSMUST00000049583,REF_NM_198248.1,GB_BC059177.1,GB_AK220256.1,
1415+7dbEST_CA752394.1,dbEST_CN685403.1,ENSMUST00000049583,REF_NM_198248.1,GB_BC059177.1,GB_AK220256.1,
1516+7dbEST_CA752394.1,dbEST_CN685403.1,ENSMUST00000049583,REF_NM_198248.1,GB_BC059177.1,GB_AK220256.1,
1617+5dbEST_CA752394.1,ENSMUST00000049583,REF_NM_198248.1,GB_BC059177.1,GB_AK220256.1,
1718+10dbEST_BQ745736.1,dbEST_CA879565.1,dbEST_CA752394.1,dbEST_CB524735.1,REF_NM_198248.1,GB_BC059177.1,GB_AK220256.1,
1819+10dbEST_BQ745736.1,dbEST_CA879565.1,dbEST_CB524735.1,dbEST_CN534795.1,REF_NM_198248.1,GB_BC059177.1,GB_AK048974.1,GB_AK220256.1,
1920+9dbEST_BB651513.1,dbEST_BQ745736.1,dbEST_CB524735.1,dbEST_CN534795.1,REF_NM_198248.1,GB_BC059177.1,GB_AK048974.1,GB_AK220256.1,
2022a+9dbEST_BB651513.1,dbEST_BQ745736.1,dbEST_CF182459.1,dbEST_CN538957.1,REF_NM_198248.1,GB_BC059177.1,GB_AK048974.1,GB_AK220256.1,
2122a+1dbEST_CR514052.1,
22a1-9dbEST_CN705709.1,dbEST_CN705520.1,dbEST_CN714498.1,dbEST_CN714754.1,