NIA Mouse Gene Index (mm92)

Exon structure for U025843

chr4 -

Exon1 151851980 - 151851510
	GGATCCAGCGATCGGGCTGCCGGTGCCCAGCGGAACCCGAGGAGTCGTGGGTCCAGTGCTGACCGAGGGGGTCACCCAATCCACCGCCACCCACGCGTGG
	AGCCCGGGCCTGAGGGATACCGCTCACTCAGCACAGAACCCGCCCCACGTCACTTTTGCGTCAAGGCCGCGCGGCCAATGAGAACCCGAGTCCAAGGATT
	CTGACTCTGCGCGCGCCCGCCAATCCACGCATCGGCGGGAGCTGCATGATTTGCATGGACTGCCTTGGCCATTGCCAATGAGACTGTGACTGGCGTGAAG
	CATAGCCAATAATAGGCTGCTAGGGGCGTGGCCGAGGGAGTCCCACGAGGTAAAGATGCTGCGGGCGGAACCTGCCGGAGCGAGCGGGATTCGGGGGTGC
	TAAAGTCGCAAGGGCAGGGCAGGAAGGAAGATCCGGAACGGGGCGTGGGATCCGGAGCTGGAGGCCCCCAG
Exon2 151847970 - 151847832
	CTCCGGCTAGGATGGGTTTCCTGACTATGCTCTCCCTGGGCAGTGAAGATCCATCACCCAACCCAGAGGCTGCAACATCTGGGTGAAGAGACACAtcttg
	gtctgtttccagttgctatgagaggatgcctgcaactag
Exon3 151829152 - 151828943
	AAGAGGCTATGACCTCCTGAGAGGAGGACACAGTGGGATGCCAAGAATGGCTAGAAAGTCAGCAAGCATTGAAGATTCAGCCGAGTATACACGAGGAGCA
	GAACCCGGTGGCCAAGACTGCACGGAGACAGGGCCGAGACGCGCCTGTGTCTCCTCTTTCCTCTGTGACCACAGGCAGGGCCAGGAGCTAGATCCCAGAA
	ACCAGGACAG
Exon4 151822964 - 151822787
	GGGCCCTGGTTTGTTAGTCTCTGAGTGTGCAGTTGCTGCACATGGGGCCCTGGCGCTTGCTGCACCAACTTCCTGTTGGGCCCGTGGTCCTTGGAGGCAT
	GCAGTTCAGCAGACAGTGACTCAGCCATCCACCCAACATGCGGAACGTGTCTCTTCTGCAGGTCCCGGTCCACAGCAG
Exon5 151810046 - 151809914
	GATTCCCCCTCTGTGAAAAGGCACGCTGATCTGTCTGGATAAGTGTGGCCGGCCCCATGTATCCGGAATCAACCACGGGGTCCCCAGCTCGACTCTCCCT
	GCGGCAGACAGGCTCCCCCGGGATGATCTACAG
Exon6 151808932 - 151808891
	TACTCGTTATGGGAGTCCCAAAAGACAGCTCCAGTTTTACAG
Exon7 151804757 - 151804724
	GGCCTTTTTAACAAGCAGCCACCCAGGGAAGCAG
Exon8 151800775 - 151800524
	CCGTGCCAGTGACCACTATCAGGGCTACCATCTATGTCCCCATCCCTTTCGACAGACACTGTTGATCTTGGTCTCCGAGAGTGAATTCGGGATCTAGACT
	GAGTGATGAATGGTTCTGGATGCATAAGCTGTGAACCTCACACTCCCAATAAGCCCACCACCTCTCCTGCCCTATTGCAGAAGCTCCAAACTGTGTGACA
	GGCTGTCACGATGCACAGAGCCCAGAGACCTCTGCTGGTGCAGCAGGATTTC
Exon9 151799954 - 151799714
	CAGTGGCAACTCCAGGCGCCATCATGCTGTCCATGACATACAGCGAGAGTCTGCGGAGCGTAAGCAGCAGATGCCATTCAGACTGGACCCTGCATCCAGT
	CCGCCAGACAGACACCCTGGAGCTGCAGCGGCTGAGGGAGGTGCGGGCAGCCGCCCAGGCCAGGAACATGGAGAGCTTCCTCCAAATGCACGGCCTTTCC
	CTGGACGGCTGCACCGCCCAGCGCACAGGCATGAAGTATCG
Exon10 151796853 - 151796819
	GGTGAGCCGTCACAGGTGTTCCGGAGTTTAGCAAG
Exon11 151792516 - 151792124
	AATTTGATGCCCTCCGCTCGGCTGCACAGGCAGGTCCTCCGCTGCCCTCAGAAATCCTTGCTCTGAGCGAACGCCCGCCACTTCTTCACCTTCTGGGATC
	AAGTCTCATCGGAAGCAGAGAGTGGGGTTCCTAAGGGACAGACGACTTCGGAATCCATCAGGGGCTGAGACTGCCCTCAACATGCAGGTATCTTTCGTGT
	GTTCAGAGCACAGCCTCAAGAGCCGTGGCCCCGAAGACCGGCTGGGTCGCTCGGCAGCCAGCAGCCCCAGCCCAGGCACCCGTGGACGCTTCCGCGCTGT
	GGCCATGGTGGCCCGGAGCCTGGGACAGCTGTCCGTGCAGAGTGCCCCAAACAGCAACGACACCAGCTTGAAGCAGCCAGGGATGAAATATAG
Exon12 151786969 - 151786926
	GAATCTGGGCAAATCTGGCCTTCGGGTCTCCTGCCTGGGGCTTG
Exon13 151786131 - 151786094
	GAACATGGGTGACCTTCGGGGGCCAGATCACGGATGAG
Exon14 151781315 - 151781236
	ATGGCAGAGCACCTAATGACCTTGGCCTACGATAATGGCATCAACCTGTTCGATACGGCGGAGGTCTACGCTGCTGGAAA
Exon15 151778753 - 151778709
	AGCTGAAGTGGTATTAGGGAACATCATTAAGAAGAAGGGATGGAG
Exon16 151777189 - 151777145
	ACGGTCCAGCCTTGTCATCACCACCAAGATCTTCTGGGGTGGAAA
Exon17 151776077 - 151776034
	AGCGGAGACTGAGAGAGGCCTTTCCAGGAAGCACATAATTGAAG
Exon18 151775143 - 151775057
	GACTGAAAGCGTCCCTGGAGCGGCTGCAGCTGGAGTACGTGGATGTGGTTTTTGCCAACCGCCCAGACCCCAACACGCCCATGGAAG
Exon19 151774374 - 151774330
	GGGACCCATTTAGTTCCTTCAAGTCACGGACATTCATCATTGAAG
Exon20 151770950 - 151770865
	AGACCGTGCGGGCCATGACCCATGTCATCAACCAGGGGATGGCCATGTACTGGGGCACATCACGCTGGAGCTCCATGGAGATCATG
Exon21 151769354 - 151769234
	GAGGCCTACTCGGTGGCTCGGCAGTTCAACCTGATCCCGCCCATCTGCGAGCAAGCGGAATATCACATGTTCCAGAGGGAGAAGGTGGAGGTCCAGCTGC
	CAGAGCTGTTCCACAAGATAG
Exon22 151769132 - 151769038
	GAGTAGGTGCCATGACCTGGTCCCCTCTGGCGTGCGGCATCGTCTCAGGGAAGTATGACAGCGGGATCCCACCCTACTCCAGAGCCTCCCTGAAG
Exon23 151768519 - 151768399
	GGCTACCAGTGGTTGAAGGACAAGATCCTGAGTGAGGAGGGTCGCCGCCAGCAGGCCAAGCTGAAGGAACTGCAGGCCATTGCCGAACGCCTGGGCTGCA
	CCCTACCCCAGCTGGCCATAG
Exon24 151767939 - 151767851
	CCTGGTGCCTGAGGAATGAGGGTGTCAGCTCCGTGCTTCTGGGTGCTTCCAATGCAGAACAACTTATGGAGAACATTGGAGCAATACAG
Exon25 151767233 - 151764849
	GTCCTTCCAAAATTGTCGTCTTCCATCGTCCACGAGATCGACAGCATTCTGGGCAATAAACCCTACAGCAAAAAGGACTATAGATCCTAAGTCTACTCCC
	CACCCCTCGTGCCCCACCCGGACAGTTCCCGGTTCCCTCCTCGTCTCTGTTCGCTCGCTTCTGCTGTTCCAAAGCCAAATGCAGAGTGTGGTTCACATCC
	AAAGGGAAATCACTATGCCCAGACGTGACAGGGAATCGACCTCCAAAGTCACCGCCAGATGCCGCCTGCCGCTTCTTCACTGGATACTGTCCGACAACGG
	ATGCCAGGGGATGGCATCAGTTAGGGGGACATCCAGAGGCTCCCGCCCAAGCCCACCACCTCTGCTTATCCTTCAAGAAGAAACACTTGCCCCCAGCCAT
	GGCCCTTCACGGAAATTCTAGAAGCCATGGCCGGGTGGAGGTCTCATCCTTAGAGCAGGAGGGGCCGCCAAGAGCCCATCTCAAAAGAGGGGTGTGCACC
	CTTCTCCCAGAGTCCTGGTGGTTAGAGCAGGGCCCTCCCTCTTTCCATGGACACCAGGTACTTTGCTCAAGGCTGGCCTGGATCCCATTCTTCCTAGGTC
	TTGACCTGCCCCACATACCCACCGAGCCTTGGCTGACATAGCTACCCAGCTGGCCCTTGGCCCCCACCCTCCCCCTTGCTGGCAGGGCCAGGGATTCCAG
	CTGGCTTTCCCAGCATCTTCCAACTGCTGAGCCCCACAGCAGGCAAGCTCAGCAGGCTTGGATGGAGCCCATCGGAGTATGCCTCTCAAGACAGACACTC
	GTGGGCAAGTGTGGCAGCTGGCCCCACCGCAGGCAGGTGGCAGCAGGCTTGCAAGACCATATTGCTCTCACAGACCTTCCAATACCTCTGCTGTACCGGG
	GCAGTGGGCTCATGATGTGGGCTTTGCCCAGATGAAGCACTTAGAGCTATGTTGCAAGCCAGGGAACTACGGGAGCAGCTCCAGTAATAGTCTCCGTGTT
	TTAAGAATAGATCCCAGAGCTTCTCCCTGGAAAAATGGCTAGGACCACCCATTCCCTTCTGCGTACCCTCATGCTGGCCTAGGGCAGGATGGGGAGAGGA
	AGTAGTGGAAAGGATAGGCAGCCCTTTATCACTGGGATAAATCCTGCATGGATGTTGATGCCAGGGAGCCTGCGGGATTGGTCAGTACACACTGCCTGGA
	GGCCCCATCCCATGGTTTTGTGATGCTCTGGGGGACAGGGTCCTACCCAGCTGCCTCCCTAGGAGACCAGCCTCCTGCCCTGCTGCACAGACCATGGCCA
	GCTCCCAGGCACAAGTCCTAGATGCTTAGCACCCTAGCTTTGCCTTCTGTAGCTGCTATTACAAGGCTGCTCCTTGCTGCTCTTAAGGCTGGGCAGAGGT
	GAGGACAGGGGTGGGGGTTGGGGGGGTTTATGGGGAGGAGACAGGAAGAAAGGCAGACAAACCCCCCCCCGAAAACCCTGAGCTCTCTAACCTTCGCTGC
	TCATAGTGCTGACCCTAAGACCTCAGAAGCAGCTCTGTGTGTGGGGGGATGGAGACCATGGGCTCTGGTATTTCCATGCCTGGCTAGCAGAGCCAGCTTT
	CTGGACAGGGCCCTGCAGTGGCCCAGCAGGAAGTACCAGACCTGTCCACACAGCTGGCCTTGGCCCTGCTTGTTAGGTGGGCCAGGCATGCAGGGATGCC
	CACAGTGGGAGCTACTGCCTGCCTGTGAACCACACCTCAGAGCTAAGCTCCTGCTGGTGATGTGCAAGAGACAGGAAAACAGGCTGCCGGGCTAAGGCCC
	ATAGGATTTAGCCCACAGGAGCCCTAGATGCAAAAGACATGTTAACCAAGTGTTTCTGAGAGGTTGTCTTCCACACCCACTCTCGAAGCGTCAGGGATTT
	GCTTCTTAAACTTCTGCGGAGGGGTTTGGCTTGGGAGGCCATGTAGAGCAAGTACAGACAGCCTGTTAGTGGGAGCTTGCCCCCAGGCCCTCAAAGGGTG
	TAAGGCCAGCTCCTTCCTCCATGGCCTCTCCTTCCTTTAGCCCAGCTGCCTGCAGGCCAGCCCAAGCCAGCTTCTCTTCACCTTGAAGTAGTCTGCCAGG
	CCTGGTGCAGGAGGAGGGCCATGTAGAGAGAGGATCTGGCACTCGGAGCCCAAGGTCCCAAGGCACAGCAGCGCACCTGTGTGCCTGCTCTCCTCATGTA
	CATACATAACGTGCTTTCTCTCCCCGTTTTTTGTTTGTTTTTTTTTAAACGAGCGTGGCTCCTCGCTAACTGCACCCCACCAGGCCGACAGCAAACGCCT
	CCAGCTTCCCGACAGACTCAGACCAAGGTGCGGCCCCGTATTTATGGAATGGCAAATAAAACCCGAGCCCTTTGGTCTCCACGTT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+2dbEST_BY288378.1,ENSMUST00000162017,
15+77dbEST_AU066635.1,dbEST_BB851057.1,dbEST_BB872173.1,dbEST_BB868653.1,REF_NM_001252654.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_AK143166.1,
35+4dbEST_BG404040.1,dbEST_BG293867.1,dbEST_CX733001.1,ENSMUST00000161236,
25+2dbEST_BY288378.1,ENSMUST00000162017,
45+45dbEST_BB842015.1,dbEST_BB867014.1,dbEST_BB842292.1,dbEST_BY177977.1,REF_NM_001252655.1,REF_NM_001252656.1,GB_L48983.1,GB_AK157053.1,GB_AK152613.1,
56+89dbEST_AU066635.1,dbEST_BB862433.1,dbEST_BB851057.1,dbEST_BB872173.1,REF_NM_001252656.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_L48983.1,GB_U65592.1,GB_AK152613.1,
68+2dbEST_BB867014.1,ENSMUST00000162518,
1112+2dbEST_BB851060.1,ENSMUST00000161844,
712+2dbEST_BB869015.1,ENSMUST00000161496,
612+80dbEST_AU066635.1,dbEST_BB851057.1,dbEST_BB872173.1,dbEST_BB842015.1,REF_NM_001252656.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_L48983.1,GB_U65592.1,GB_AK152613.1,
1012+2dbEST_BY716781.1,ENSMUST00000159844,
912+2dbEST_BY127204.1,ENSMUST00000162165,
512+33dbEST_BY731396.1,dbEST_BY155784.1,dbEST_BY189441.1,dbEST_BY187809.1,REF_NM_001252655.1,REF_NM_001252654.1,GB_AK143166.1,GB_AK157053.1,
1213+118dbEST_AU066635.1,dbEST_BB869015.1,dbEST_BB862433.1,dbEST_BB851057.1,REF_NM_001252655.1,REF_NM_001252656.1,REF_NM_001252654.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_AK143166.1,GB_L48983.1,GB_U65592.1,GB_AK157053.1,GB_AK152613.1,
514+2dbEST_BY177977.1,ENSMUST00000159435,
1314+64dbEST_AU066635.1,dbEST_BB869015.1,dbEST_BB862433.1,dbEST_BB851057.1,REF_NM_001252655.1,REF_NM_001252656.1,REF_NM_001252654.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_AK143166.1,GB_L48983.1,GB_U65592.1,GB_AK157053.1,GB_AK152613.1,
1415+32dbEST_AU066635.1,dbEST_BB869015.1,dbEST_BU612204.1,dbEST_BY716781.1,REF_NM_001252655.1,REF_NM_001252656.1,REF_NM_001252654.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_AK143166.1,GB_L48983.1,GB_U65592.1,GB_AK157053.1,GB_AK152613.1,
1516+29dbEST_BB869015.1,dbEST_BU612204.1,dbEST_BY716781.1,dbEST_BY731396.1,REF_NM_001252655.1,REF_NM_001252656.1,REF_NM_001252654.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_AK143166.1,GB_L48983.1,GB_U65592.1,GB_AK157053.1,GB_AK152613.1,
1617+27dbEST_BB869015.1,dbEST_BU612204.1,dbEST_BY716781.1,dbEST_BY731396.1,REF_NM_001252655.1,REF_NM_001252656.1,REF_NM_001252654.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_AK143166.1,GB_L48983.1,GB_U65592.1,GB_AK157053.1,GB_AK152613.1,
1718+27dbEST_AV155070.1,dbEST_BU612204.1,dbEST_BY503377.1,dbEST_BY716781.1,REF_NM_001252655.1,REF_NM_001252656.1,REF_NM_001252654.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_AK143166.1,GB_L48983.1,GB_U65592.1,GB_AK157053.1,GB_AK152613.1,
1819+1ENSMUST00000159186,
1820+27dbEST_AV155070.1,dbEST_BU612204.1,dbEST_BY503377.1,dbEST_BY716781.1,REF_NM_001252655.1,REF_NM_001252656.1,REF_NM_001252654.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_AK143166.1,GB_L48983.1,GB_U65592.1,GB_AK157053.1,GB_AK152613.1,
1920+1ENSMUST00000159186,
2021+26dbEST_BU612204.1,dbEST_BY503377.1,dbEST_BY716781.1,dbEST_CA317377.1,REF_NM_001252655.1,REF_NM_001252656.1,REF_NM_001252654.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_AK143166.1,GB_L48983.1,GB_U65592.1,GB_AK157053.1,GB_AK152613.1,
2122+28dbEST_BI730696.1,dbEST_BY565845.1,dbEST_BY716781.1,dbEST_CA317377.1,REF_NM_001252655.1,REF_NM_001252656.1,REF_NM_001252654.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_AK143166.1,GB_L48983.1,GB_U65592.1,GB_AK157053.1,GB_AK152613.1,GB_AK200584.1,
2223+23dbEST_BI730696.1,dbEST_BY565845.1,dbEST_CD353749.1,dbEST_CJ236968.1,REF_NM_001252655.1,REF_NM_001252656.1,REF_NM_001252654.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_AK143166.1,GB_L48983.1,GB_U65592.1,GB_AK157053.1,
2324+26dbEST_BI732472.1,dbEST_BI730696.1,dbEST_BY565845.1,dbEST_CB274152.1,REF_NM_001252655.1,REF_NM_001252656.1,REF_NM_001252654.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_AK143166.1,GB_L48983.1,GB_U65592.1,GB_AK157053.1,
2425+24dbEST_BI732472.1,dbEST_BI730696.1,dbEST_BY565845.1,dbEST_CB274152.1,REF_NM_001252655.1,REF_NM_001252656.1,REF_NM_001252654.1,REF_NM_010598.3,GB_BC039178.1,GB_U31908.1,GB_AK143166.1,GB_L48983.1,GB_U65592.1,GB_AK157053.1,