NIA Mouse Gene Index (mm92)

Exon structure for U025970

chr5 -

Exon1 21850523 - 21849998
	CCCAAGCCCGGCCGAGGGGCGTCGCGTGCACACCGGCGGCGGCGGCGCTCGGAGGCGGACGACGCGCTCTCGGCGCCCGCGGCCCCGGTTCCCCCCGCGC
	TCTCGCTCCGGCGGCCCAAAGTAACTTCGGGAGCCTCGGTCTCCCGCTAACTTCCCCCCGCGGGCTCGGTTGCCCGGACCCGCTCGGCTCGAGCCCGCCG
	CCGGCTCGCCTTCCCCGCACGCGGCTCCTCCGTGCCGGTGCCTCCGAAAGTGGATGAGAGAgcgcgcggggcgcgcggcggcacggagcgcggcggcATG
	GAGCGCGGCTGCTGGGCGCCGCGGGCTCTCGTCCTGGCCGTGCTGCTGCTGCTGGCGACGCTGAGGGCGCGCGCGGCCACCGGCTACTACCCGCGCTTCT
	CGCCTTTCTTTTTCCTGTGCACCCACCACGGGGAGCTGGAAGGGGATGGGGAGCAGGGCGAGGTGCTCATTTCCCTGCACATTGCGGGCAACCCCACCTA
	CTACGTACCGGGACAGGAATACCATG
Exon2 21849920 - 21847887
	GGGCCAGCCGGCCGGAGACCGGGACAACCTCCTACCTCAGCGGGGTGCGCTGCCTGGGGAGAGAGAACAAAGTTAGTGGAGAATGGAGTCCTGAGTTGGG
	ATTTCAACTGTCCCCTAACACATAAACTGGTGCTTATGTGACAGGCCACACAAGCTTTTGGTACTGCTGTCCCCCACCCCTTCACTCCCTGCAGCTGCCG
	AACCTGCGCATCGTGTTTTCCTAACCCCAGTACTTAGATACCAGACTTTTGTCCTGTTCTGGGTCCTCCTTGGTGGGTCCCCAGGTGGCGCTGGGGTTGT
	CACTGGGTTTTGCCGGCCAGCTGCCGACAGATTGGAGCACTTTGGTCGGTGGCTGCCCATGCCGGCGGCCAGTTAAAAGTTCCCGCTGCTCTGCAGCCAG
	GAGTCCCTAGTGATCTGTCCTCAAGAAACAGAGCGGCTGTTTCCAACCCTTTATTCTTTTAAAGAGTCGTTTAAAATATCAGTGATTGATGATTTCTGTC
	ATCCCCTTCATACTTTTAGCTTGGTGCTTGCTGTTGTTAGCATTGTCTGGGCGATGCTTACTAATCACTTGTATCTGCACAGCTTTAAGTCCCTGGCAGG
	ACCTACAAGCTTCTCCCCACAAAGGCGATCCCTCTCCTAAGGGATCAGTATGCAATCCTTCATCGAGGTGAAACATTACTGCAAAGTTGAATTTTAGCAA
	CAAGAAGAGTAATTTAATGTAGTATGCAGTCCTTCATCGAGGTTAAAACATTACTCAAAAATAAAAATTAGCTACAAGAAGAGCAATTTAGTGTAGTCCA
	TATACTTTTAATCAAGTGAAATATGTGGGAGATAAACCATGTGTACTTTCTGTCTTCATTCTGGGACTTCTTAATGATAGGAAATGTTAAATTGGAAAAT
	TTCCATAAAATATTTATACCCAATGACATAAACTATCATTGAGTGAACTCATGCCATCCCAAGGGTGCTGTCTGTAATAGGCTACAGGTGTTGACAGAGC
	AGAAGGTGGCTGGCATTTCACATAGATTTGGGAGTGAAAATTTTGTAAAAATGCTAAAGAGTTTTCTGTTTCAGTAAAACCTTCCTACCCACCTCCAAAT
	GGCTTTGGCTGAGTCTGTTCATCCTAGATATTTACACCAGTGGCTTTAACAACTTCCTCAGAGGGGTGGCAGCCTTGTTCCTGCAATTTCATAATTTAAT
	TTTAGGAAATCAATTTCTGTAACTAGTCCTTTAAATAAAAGGGTTTGCTTGTACGTGTTCCCTTCCCAACAGTTATCTGGTGCTTTTTCTGAGATCATGG
	AAATCTTTGCAGTGAAAGGAACGCCAGTGTGGTGACCACCCAGACCTAACCTACAGACTGACTGAGACAGTGGTCACTTGGCGTGCCCCTTAGCAGACGT
	GTAGCTGGTTATCTGTGAGAGCCGCTAGTCGGTGAGTGAGTGAATGCTGGTCTAAAAGGTGCTCCTGTCAAGCTGTGAGGGGTGTCTCTGATGACAGAGC
	CGCATCAGCCCCCACCACACAGACCCTTTGTACATCACTGCTGAAGGGAGTATCAGTGAGACTGAGAATAACCATCTACAGCTTTTGGGTTTGCTGTAAA
	GTTGGCAGATGAACCACAGCCTGACTGCAGTCATGTCACTAAGCCTGAAAAGAGGGGAATGAATGCATTCTTTCAGACTGGACATTGTAGGGAACAGGTC
	CCCAGAACCTCTCTTATGCCACCAGAAAAGATGGAGGGATTTTATCATGTAACTTGAAAGGTCAAATTATTAGAGTAATGCCATTTTAAATTCCTATTAA
	ATATTGTATCAAAGTTTAAGCTTTGGGAACCAGCTGTATAACTCTAGGCCTTCAGTGTTTTTCCTATAAAATGCTCTACAGGTAGGAGAAATGCTTAAAA
	CTGAAATTATACATATATGTGGCTTTTTAATTATTAAACCTTTGGAAATGAAAAAAATAGCATCTGTAAGAATTGACTCACTATAGGAAAACATAATAAA
	TACATTTGTGGTTGACTCATTTTGATGAATGTTG
Exon3 21792821 - 21792711
	TTACAATTTCAACAAGCACCTTCTTTGATGGCTTGCTGGTGACGGGACTCTATACCTCGACAAGCATCCAGTCTTCTCAGAGCATTGGAGGCTCCAGCGC
	CTTTGGATTCG
Exon4 21733478 - 21733343
	GGATCATGTCCGACCACCAGTTTGGTAACCAGTTTATGTGCAGTGTGGTGGCCTCTCATGTGAGTCACCTGCCTACAACCAACCTCAGCTTTGTCTGGAT
	TGCCCCACCAGCTGGCACAGGCTGTGTGAATTTCAT
Exon5 21677098 - 21677028
	GGCTACTGCAACACATAGGGGCCAGGTGATTTTCAAAGACGCACTGGCCCAGCAGCTGTGTGAACAAGGAG
Exon6 21660795 - 21660763
	CTCCCACAGAGGCCACTGCTTACTCGCACCTTG
Exon7 21658304 - 21658226
	CTGAAATACACAGTGACAGTGTGATCCTACGAGATGACTTTGACTCCTACCAGCAACTGGAATTGAACCCCAACATATG
Exon8 21640511 - 21640415
	GGTTGAATGCAGCAACTGTGAGATGGGAGAGCAGTGTGGCACCATCATGCATGGCAATGCTGTCACCTTCTGTGAGCCGTACGGCCCTCGAGAGCTG
Exon9 21634484 - 21634433
	ACCACCACATGCCTGAACACAACAACAGCATCTGTCCTCCAGTTTTCCATTG
Exon10 21611923 - 21611827
	GGTCAGGATCATGTCGATTTAGTTACTCTGACCCCAGCATCACTGTGTCATACGCCAAGAACAATACCGCTGATTGGATTCAGCTGGAGAAAATTAG
Exon11 21609282 - 21609042
	AGCCCCTTCCAATGTGAGCACAGTCATCCACATCCTGTACCTCCCCGAGGAAGCCAAAGGGGAGAGCGTGCAGTTCCAGTGGAAACAGGACAGCCTGCGA
	GTGGGTGAGGTGTATGAGGCCTGCTGGGCCCTGGATAACATCCTGGTCATCAATTCAGCCCACAGAGAAGTCGTTCTGGAGGACAACCTCGACCCGGTCG
	ACACGGGCAACTGGCTCTTCTTCCCTGGAGCAACGGTCAAG
Exon12 21586641 - 21586496
	CATAGCTGTCAGTCAGATGGGAACTCCATTTATTTCCATGGAAATGAAGGCAGCGAGTTCAATTTTGCCACCACCCGGGATGTAGATCTTTCTACAGAGG
	ATATTCAAGAGCAGTGGTCAGAAGAATTTGAGAGCCAGCCCACAGG
Exon13 21566218 - 21566067
	ATGGGATATCTTGGGAGCAGTAGTTGGTGCAGACTGTGGAACCGTAGAATCAGGACTATCACTGGTGTTCCTCAAAGATGGAGAGAGGAAGCTTTGCACC
	CCCTACATGGATACAACTGGTTATGGCAACCTGAGGTTCTACTTCGTTATGG
Exon14 21557218 - 21557106
	GAGGAATCTGTGACCCTGGAGTCTCTCATGAAAACGATATCATCTTATATGCAAAGATTGAAGGAAGAAAAGAACACATTGCACTGGACACTCTTACCTA
	TTCTTCCTATAAG
Exon15 21555630 - 21555422
	GTTCCGTCTTTGGTTTCTGTGGTCATCAACCCTGAACTTCAGACACCTGCCACCAAATTTTGTCTCAGGCAAAAGAGCCACCAAGGGTATAATCGGAATG
	TCTGGGCTGTGGACTTCTTCCATGTGCTGCCCGTTCTCCCTTCAACAATGTCTCACATGATCCAGTTTTCTATTAATTTGGGATGCGGCACACACCAGCC
	TGGGAACAG
Exon16 21554664 - 21554536
	CGTCAGCTTGGAGTTTTCTACTAACCATGGACGGTCCTGGTCCCTACTCCACACTGAGTGCTTGCCGGAGATCTGTGCAGGCCCCCACCTCCCCCACAGC
	ACTGTCTACTCCTCAGAAAACTACAGCGG
Exon17 21553870 - 21553761
	GTGGAACCGAATCACGATTCCTCTCCCTAATGCAGCACTCACCCGAGACACCAGGATTCGCTGGAGACAAACAGGCCCAATCCTGGGAAATATGTGGGCA
	ATTGATAATG
Exon18 21550848 - 21550782
	TTTATATAGGTCCTTCGTGTCTCAAATTCTGTTCTGGCAGAGGACAATGCACTCGGCATGGCTGCAA
Exon19 21546354 - 21546121
	GTGTGACCCAGGATTTTCTGGCCCAGCTTGTGAGATGGCATCTCAGACATTCCCAATGTTTATTTCGGAAAGCTTTGGCAGTGCCAGACTTTCCTCTTAC
	CATAACTTTTACTCTATCCGTGGTGCTGAAGTCAGCTTTGGTTGTGGTGTCTTAGCCAGTGGTAAGGCTCTGGTTTTCAACAAAGATGGGAGGCGGCAGC
	TAATCACGTCCTTTCTGGACAGCTCGCAGTCCAG
Exon20 21545490 - 21545329
	GTTTCTTCAGTTTACACTGAGGCTGGGGAGCAAGTCTGTGCTGAGCACGTGCAGAGCCCCTGACCAGCCGGGGGAGGGAGTCCTGCTGCACTATTCATAT
	GACAACGGGATAACATGGAAACTCCTGGAGCACTATTCCTACGTCAACTACCACGAGCCCAG
Exon21 21540617 - 21540381
	AATAATCTCTGTAGAGCTACCGGATGATGCAAGACAGTTTGGAATCCAGTTCAGATGGTGGCAGCCTTACCATTCTTCCCAAGGAGAAGACGTGTGGGCC
	ATTGATGAGATTGTCATGACCTCAGTCCTGTTCAACAGCATCAGTCTCGACTTTACCAATCTTGTGGAAGTCACTCAATCCCTGGGATTCTACCTTGGCA
	ATGTTCAACCATACTGTGGCCATGACTGGACGCTTTG
Exon22 21524862 - 21524670
	TTTTACGGGAGATTCTAAACTTGCCTCAAGCATGCGCTATGTGGAAACACAGTCCATGCAGATCGGAGCATCCTATATGATTCAGTTCAGCCTAGTGATG
	GGATGTGGCCAGAAATACACTCCTCACATGGACAACCAGGTGAAGCTGGAGTACTCAGCCAACCACGGCCTTACATGGCACCTTGTACAAGAA
Exon23 21523953 - 21523841
	GAATGCCTTCCCAGTATGCCAAGCTGCCAGGAATTTACATCTGCCAGCATTTACCATGCCAGCGAGTTCACACAGTGGAGAAGAGTCACTGTTGTTCTTC
	CCCAGAAAACATG
Exon24 21516992 - 21516855
	GTCCGGTGCCACCCGCTTCCGTTGGAGTCAGAGCTATTACACAGCCCAGGATGAGTGGGCTTTAGACAACATTTACATTGGGCAGCAGTGCCCCAACATG
	TGCAGTGGGCATGGCTCATGTGACCATGGCGTGTGCAG
Exon25 21516120 - 21515934
	GTGTGACCAGGGATACCAGGGCACTGAATGCCACCCAGAAGCTGCACTTCCTTCCACGATTATGTCAGATTTTGAGAACCCGAGCAGTTGGGAATCAGAC
	TGGCAGGAAGTTATTGGGGGAGAAGTTGTAAAGCCTGAGCAAGGCTGTGGAGTCGTGTCTTCTGGATCTTCTCTGTACTTCAGCAAG
Exon26 21510060 - 21509855
	GCTGGGAAGAGGCAGCTGGTGAGCTGGGACCTGGACACATCCTGGGTGGACTTTGTCCAGTTCTACATCCAGATAGGAGGAGAGAGTGCTGCATGCAACA
	AGCCTGACAGCAGAGAGGAGGGCATTCTGCTCCAGTATAGCAACAACGGGGGCATCCAGTGGCACCTGCTGGCAGAGATGTACTTCTCAGACTTCAGCAA
	ACCCAG
Exon27 21504530 - 21504359
	ATTTGTCTACCTGGAGCTCCCAGCTGCTGCGAAGACCCCTTGTACCAGGTTCCGCTGGTGGCAGCCTGTGTTCTCGGGGGAGGACTATGACCAGTGGGCC
	GTTGATGATATCATCATTCTGTCAGAGAAGCAGAAGCAGGTTATTCCAGTTGTCAACCCAACTTTGCCCCAG
Exon28 21503904 - 21503704
	AACTTCTATGAGAAGCCAGCTTTCGATTACCCTATGAACCAAATGAGTGTGTGGCTAATGTTGGCCAATGAAGGCATGGCTAAAAACGACAGCTTCTGTG
	CGACCACGCCGTCAGCCATGGTGTTTGGAAAGTCAGATGGAGACCGGTTTGCAGTAACTCGAGATCTGACCCTGAAACCTGGATATGTGCTGCAGTTCAA
	G
Exon29 21501403 - 21501171
	CTAAACATAGGCTGCACCAGCCAGTTCAGCAGCACTGCCCCGGTTCTCCTGCAGTATTCACATGATGCCGGCATGTCGTGGTTTCTGGTGAAGGAAGGAT
	GCTTCCCAGCGTCAGCAGGCAAAGGATGTGAAGGGAACTCCAGGGAATTGAGTGAGCCTACTGTCTATTATACTGGGGACTTCGAAGAATGGACTAGAAT
	CACCATTGCCATTCCAAGGTCCCTTGCATCCAG
Exon30 21494628 - 21494471
	CAAGACCAGATTCCGATGGATCCAAGAGAGCAGCTCTCAGAAGAATGTGCCCCCGTTTGGCTTAGATGGGGTGTACATATCTGAGCCTTGTCCCAGTTAC
	TGCAGTGGCCATGGAGACTGCATCTCGGGGGTGTGTTTTTGTGACCTGGGGTACACAG
Exon31 21492952 - 21492745
	CTGCACAAGGAACCTGTGTGTCAAACACCCCTAACCACAGTGAGATGTTCGACAGGTTTGAGGGGAAGCTAAGCCCACTGTGGTACAAAATCACCGGGGG
	TCAGGTTGGCACGGGCTGTGGCACCCTCAATGACGGCAGGTCCCTCTACTTTAATGGCCTTGGGAAAAGGGAAGCCAGGACAGTCCCACTGGACACCAGG
	AATATCAG
Exon32 21491691 - 21491615
	ACTTGTTCAGTTTTATATACAAATTGGAAGTAAAACATCAGGGATTACGTGCATCAAACCACGGGCTAGAAATGAGG
Exon33 21485944 - 21485786
	GGCTTGTTGTTCAGTATTCCAATGATAATGGGATACTTTGGCATTTGCTGAGAGAGTTGGATTTCATGTCATTCCTGGAGCCACAGATCATTTCCATTGA
	CCTGCCCCGGGAAGCAAAGACACCTGCCACAGCTTTCCGGTGGTGGCAGCCGCAGCATG
Exon34 21485583 - 21485395
	GGAAGCATTCGGCCCAGTGGGCTTTGGATGATGTCCTTATAGGAGTGAATGACAGCTCTCAAACTGGATTTCAAGATAAATTTGATGGCTCCATAGACTT
	GCAAGCCAACTGGTATCGAATCCAGGGAGGCCAAGTTGATATCGACTGCCTCTCTATGGACACTGCCCTTATATTCACTGAAAACATAG
Exon35 21484878 - 21484605
	GAAAACCTCGCTATGCTGAGACCTGGGACTTCCATGTGTCAGCGTCAAGCTTCTTACAGTTTGAAATGAACATGGGCTGCAGCAAGCCTTTCAGTGGTGC
	CCACGGCATACAGCTCCAGTACTCTCTGAACAACGGCAAGGACTGGCAGCTTGTCACCGAAGAGTGTGTCCCTCCAACCATTGGCTGCGTGCACTACACA
	GAGAGTTCAACTTACACATCAGAAAGATTCCAGAACTGGAGGCGGGTCACGGTCTACCTGCCACTCGCCACCAA
Exon36 21482488 - 21482348
	TTCTCCCAGGACTCGGTTCAGATGGATTCAGACCAACTATACTGTTGGAGCAGATTCCTGGGCTATTGATAATGTCATCCTGGCCTCGGGCTGTCCTTGG
	ATGTGCTCAGGACGAGGGATCTGTGATTCGGGGCGCTGTGT
Exon37 21482244 - 21482067
	GTGTGACCGGGGCTTCGGTGGACCCTTCTGTGTTCCTGTTGTTCCTCTTCCCTCCATTCTAAAAGATGATTTCAATGGGAACTTACATCCTGACCTTTGG
	CCTGAAGTGTACGGGGCAGAGAGGGGCAATCTGAATGGCGAAACCATCAAATCCGGAACATGTCTGATCTTTAAAGGG
Exon38 21478757 - 21478673
	GAGGGACTAAGAATGCTTATTTCCAGAGATCTAGATTGCACCAATACTATGTATGTCCAGTTCTCTCTCCGATTTATAGCGAAAG
Exon39 21477867 - 21477685
	GTACCCCAGAGAGGTCTCACTCCATCCTTCTACAGTTCTCTGTCAGTGGAGGAGTCACCTGGCACCTGATGGATGAATTCTACTTCCCTCAAACGACCAG
	CATACTTTTCATCAATGTTCCCTTACCATACGGTGCCCAAACCAACGCTACAAGATTCAGACTCTGGCAACCGTACAATAATG
Exon40 21475221 - 21475050
	GTAAGAAAGAAGAAATCTGGATCATTGATGACTTTATTATTGATGGAAACAATTTGAACAACCCCGTGCTGCTGCTGGACACGTTCGACTTTGGGCCCAG
	GGAAGACAATTGGTTTTTCTATCCGGGTGGTAATATCGGACTTTACTGCCCGTATTCTTCAAAGGGAGCTCC
Exon41 21474949 - 21474847
	TGAGGAGGATTCGGCCATGGTGTTTGTTTCAAACGAAGTTGGAGAACACTCCATTACCACACGAGACCTAAGTGTGAACGAGAACACCATCATTCAATTT
	GAG
Exon42 21466301 - 21466072
	ATCAATGTTGGCTGCTCCACTGATAGTTCTTCTGCTGATCCGGTCAGACTGGAATTCTCAAGGGACTTTGGAGCCACCTGGCACCTGCTGCTGCCTCTCT
	GCTACCACAGCAGCAGCCTCGTCAGCTCCTTATGCTCCACTGAGCATCACCCGAGCAGCACCTACTACGCGGGGACCACCCAGGGCTGGCGGCGGGAGGT
	CGTGCACTTCGGAAAGCTGCACCTTTGTGG
Exon43 21461082 - 21460862
	ATCTGTGCGTTTCCGTTGGTACCAGGGATTTTATCCTGCTGGCTCTCAGCCGGTCACATGGGCCATTGACAATGTCTACATTGGTCCCCAGTGTGAAGAG
	ATGTGCTATGGGCACGGGAGCTGCATCAATGGAACCAAGTGTATATGTGACCCGGGCTACTCTGGGCCAACCTGTAAAATAAGCACCAAAAATCCTGATT
	TTCTCAAAGACGACTTTGAAG
Exon44 21456784 - 21456637
	GTCAACTGGAATCCGATCGATTCTTACTGATGAGCGGTGGGAAGCCGTCTCGTAAGTGTGGCATCCTTTCCAGTGGGAACAACCTCTTCTTCAATGAGGA
	CGGCTTGCGCATGCTAGTAACACGGGACCTGGATTTATCACATGCAAG
Exon45 21454448 - 21454190
	GTTTGTGCAGTTCTTCATGAGACTGGGATGTGGTAAAGGTGTTCCAGACCCCAGGAGCCAGCCCGTGCTTCTGCAGTACTCCCTCAATGGCGGCCTCTCC
	TGGAGTCTTCTTCAAGAGTTCCTCTTCAGCAACTCCAGCAATGTGGGCAGGTACATTGCCCTGGAAATGCCCCTGAAAGCCCGTTCTGGTTCGACACGCC
	TCCGCTGGTGGCAGCCATCTGAAAATGGGCACTTCTATAGCCCCTGGGTGATCGACCAG
Exon46 21453351 - 21453102
	ATTCTTATTGGAGGAAATATCTCTGGTAATACAGTCTTAGAAGATGATTTCTCAACTCTGGACAGCAGAAAGTGGCTGCTTCACCCAGGAGGCACCAAGA
	TGCCTGTGTGTGGCTCCACAGGCGATGCCCTGGTCTTTATTGAAAAGGCCAGCACCCGTTACGTGGTCACGACAGACATCGCTGTGAATGAGGACTCATT
	CCTACAGATAGACTTTGCTGCCTCCTGCTCAGTCACAGACTCCTGCTATG
Exon47 21448585 - 21448417
	CTATTGAACTGGAGTACTCGGTGGATCTCGGTCTGTCGTGGCACCCGCTGGTGAGGGACTGCCTGCCTACCAATGTTGAGTGTAGTCGTTACCACCTGCA
	GCGGATCCTGGTGTCAGATACTTTCAACAAGTGGACCAGAATCACTCTGCCCCTGCCTTCCTACACCAG
Exon48 21438658 - 21438518
	GTCTCAAGCCACTCGTTTCCGCTGGCATCAGCCAGCGCCTTTTGACAAGCAGCAGACCTGGGCAATAGATAATGTCTATATTGGGGATGGTTGCCTAGAC
	ATGTGCAGTGGCCACGGGAGATGCGTCCAGGGAAGCTGTGT
Exon49 21437353 - 21437176
	CTGTGATGAACAGTGGGGAGGCCTGTACTGTGATGAGCCTGAGACCTCCCTTCCCACCCAGCTCAAAGACAACTTCAACCGAGCCCCCTCCAACCAGAAC
	TGGCTGACTGTGAGCGGTGGGAAGCTGAGTACAGTGTGTGGGGCTGTGGCTTCCGGCCTGGCTCTCCATTTCAGTGGG
Exon50 21435075 - 21434882
	GGCTGCAGCCGATTGTTAGTCACTGTGGATCTGAACCTCACCAATGCTGAGTTTATCCAGTTTTACTTTATGTATGGATGCCTCATTACGCCGAGCAACC
	GTAACCAGGGAGTCCTGCTGGAGTACTCTGTCAATGGAGGCATCACCTGGAACTTGCTGATGGAGATTTTCTATGACCAGTACAGCAAACCTGG
Exon51 21431264 - 21431008
	ATTTGTGAATATCCTTCTCCCTCCTGATGCTAAAGAGATTGCCACTCGCTTCCGATGGTGGCAGCCACGACATGATGGCCTTGACCAGAATGACTGGGCC
	ATTGACAATGTCCTCATCTCGGGCTCTGCGGACCAGAGGACAGTCATGCTGGACACCTTTAGCAGCGCCCCAGTACCACAGCATGAGCGCTCCCCCGCAG
	ACGCTGGCCCTGTTGGAAGAATTGCTTTTGAAATGTTCTTAGAAGACAAAACTTCAG
Exon52 21426379 - 21426225
	TGAATGAGAATTGGCTCTTCCATGATGACTGTACAGTGGAAAGATTCTGTGACTCGCCAGATGGTGTCATGCTCTGTGGCAGCCATGATGGACGAGAGGT
	GTATGCAGTGACTCATGACCTGACGCCCACTGAGAACTGGATCATGCAGTTCAAG
Exon53 21425047 - 21424833
	ATCTCTGTTGGATGCAAAGTGCCTGAAAAAATTGCCCAGAATCAAATTCACGTGCAGTTTTCTACTGACTTTGGCGTGAGCTGGAGTTATTTAGTCCCTC
	AGTGCTTACCCGCCGACCCAAAGTGTTCTGGAAGCGTTTCTCAACCGTCTGTGTTCTTCCCAACTGAAGGGTGGAAAAGGATCACCTACCCGCTTCCTGA
	AAGCTTAACGGGGAA
Exon54 21420978 - 21420801
	TCCTGTAAGATTTAGGTTCTACCAAAAGTACTCAGATGTGCAGTGGGCAATTGACAATTTCTACCTTGGCCCTGGATGTTTGGACAACTGTGGAGGCCAC
	GGAGACTGCCTAAAGGAACAGTGTATCTGTGACCCAGGCTACTCAGGGCCAAACTGCTACTTAACTCACAGCCTGAAG
Exon55 21419192 - 21419017
	ACTTTCCTGAAGGAGCGCTTTGACAGTGAGGAGATCAAGCCTGACTTATGGATGTCCTTGGAAGGCGGAAGCACTTGTACAGAGTGCGGGGTCCTCGCCG
	AGAACACTGCACTCTATTTTGGGGGATCCACTGTGAGACAAGCTATTACTCAAGACTTAGATCTCAGAGGTGCAAA
Exon56 21418900 - 21418794
	ATTCCTGCAGTACTGGGGACGTATCGGCAGTGAGAACAACATGACATCTTGCCATCGGCCTGTCTGCCGGAAGGAAGGCGTGCTGCTGGACTTCTCTACG
	GATGGAG
Exon57 21416873 - 21416631
	GAATCACTTGGACCTTGCTTCACGAGATGGATTTCCAGAAATACATTTCTGTGAGGCACGACTACATCCTCCTGCCTGAGGGGGCCCTCACCAACACAAC
	TCGACTTCGCTGGTGGCAGCCTTTTGTCATCAGCAATGGGCTCGTGGTTTCCGGGGTGGAGCGTGCGCAGTGGGCACTGGACAACATTCTGATTGGTGGA
	GCAGAAATCAATCCAAGCCAACTGGTGGACACTTTCGATGACG
Exon58 21415934 - 21415759
	AAGGCTCCTCCCATGAAGAAAACTGGAGTTTTTACCCTAATGCAGTAAGGACAGCAGGATTCTGTGGCAACCCATCCTTCCACCTCTACTGGCCAAATAA
	AAAGAAGGACAAGACCCACAATGCACTCTCCTCCCGAGAGCTCATTATACAGCCAGGATACATGATGCAATTTAAA
Exon59 21410556 - 21410483
	ATTGTGGTGGGTTGTGAAGCCACTTCATGTGGTGACCTTCATTCCGTGATGCTGGAGTACACCAAGGATGCAAG
Exon60 21408757 - 21408596
	GTCCGATTCCTGGCAGCTCGTGCAGACCCAGTGCCTACCTTCCTCTTCCAATAGCATTGGCTGCTCCCCGTTCCAGTTCCATGAAGCCACCATTTATAAT
	GCTGTCAACAGCTCAAGCTGGAAGAGGATCACCATCCAGCTCCCAGACCACGTCTCGTCAAG
Exon61 21407580 - 21407423
	TGCCACACAGTTCCGCTGGATCCAGAAGGGAGAAGAAACCGAGAAGCAAAGCTGGGCCATCGACCACGTGTACATCGGAGAGGCTTGTCCCAAGCTCTGC
	AGCGGGCATGGCTACTGCACCACAGGGGCCGTCTGCATCTGCGATGAAAGCTTCCAAG
Exon62 21405023 - 21404804
	GTGACGACTGCTCTGTCTTCAGTCACGAGCTTCCTAGTTACATTAAAGATAATTTTGAATCAGCAAGAGTCACTGAAGCCAACTGGGAAACCATCCAGGG
	TGGAGTGATCGGAAGTGGCTGTGGGCAGCTGGCGCCCTATGCCCATGGAGATTCGCTCTACTTTAATGGTTGTCAGATAAGGCAAGCTGCCACCAAGCCA
	CTGGACCTCACTCGAGCAAG
Exon63 21402762 - 21402565
	CAAAATTATGTTTGTCTTGCAAATTGGGAGCCCAGCCCAGACAGACAGTTGCAACAGCGACCTCAGCGGCCCCCACACCGTGGACAAAGCAGTACTGCTG
	CAGTACAGTGTCAACAATGGCATCACCTGGCACGTCATCGCTCAGCACCAGCCGAAGGACTTCACACAAGCTCAGCGGGTGTCTTACAACGTCCCCCT
Exon64 21401905 - 21401807
	GGAAGCTCGGATGAAAGGAGTTCTACTGCGCTGGTGGCAGCCACGCCACAATGGAACAGGTCATGATCAATGGGCTTTGGACCATGTGGAGGTCGTCCT
Exon65 21397515 - 21397380
	AGATGAAAAATCCTATATTGCGCCTAAGCCCGGTCAGACTTTTATGAGTAATCACAGTGCTGCATGCGTTGAGAAGCATTTTTTAACTTGTATTATATTT
	CATTATTTGCTGTCATTGGTTTTCTACTAGAGTAAG
Exon66 21391387 - 21390272
	CACTCGCAAACAAAATTACATGATGAATTTTTCACGGCAACATGGGCTCAGGCACTTCTACAACAGAAGACGAAGGTCGCTTAGGCGATACCCATGAAGA
	ATCCAAGTTTATTTCCCTTTCCAGCGTACAATGTGTCCCTTCCTGGTTTTTTGAAACACCTCTCACTGCATCTGATATCAGGAAACAAAGATGAAGGACT
	TGGCGAACAGAAAGCCCTTCGAGATCTTGTGTACCCCACCTTCCCACACTGTGAGCTAATGATGTGTGGTTTCTCTGCACATAAGTAAATGTCTTCACGT
	CAGTGCGTCCGTGGAAATTGTGATCTGTTGTAATATCAGTTACAGTGGCAGTATTGAGAATAAGAAATAGTTTAACAGGAAAAAACGTTTAAGCACAAAC
	ATTTTTAAGATCTTATGTTTTAAGTGGCATTTTAGCACAGTATTTAACATTGTTGGTCACCGAGCTATTTAAGTAGACTGTATTTCAGCTCTGTCTCTTG
	TTTATATGAATAAGTTCTCGTCGTTTGTCCTTTATGTATTCTTCTCTACCGTATAACACACTGAAACTGTATCTACTTGCTGTGTTGCAATATTTTGCTG
	CTGGACTTTGACCTACTTGTATTATGCAGAAAGTTAATGCAGATACCTATTCAAGATGATAACTGTAAAGACACTGCTGTCTCCTTAATATGCTCCTTAA
	CACGTATGTTGATGTAGCATCATTTTGTGGATAGGAAAAAAAATGTTTGACCTTCAGATATTTTCTACTTAAAAAATTGTGGATGAACGCCCTATCTCCC
	TCCCACAGTGGAGTCCCCATTACCTTGTCTAAAACAATTTTTTAATGTGTTCTGTGGCCGTTTTACTGACAGTAACTGCCATTTCGTGTCTGTGGTAACA
	AAGTGACTTGTAAAATGGTGGATGTTTCCCTCACTGTGTTCTCTTCGTGGGTTGTTTCCTTGTGGGTCATAGTCATACCTTCTGATGAGGTGGAGCCAAC
	ACCAGCAAAGTATGATGGCCCTGTAGCCTCTGACTAGTCCTGAAACAGAAGGCTGCACTCTAGGCTGAACCATGCTAAAAGCCCATGCTTAAATAAAAAA
	TTATGTCCAAAATCTA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+4ENSMUST00000161782,ENSMUST00000061408,GB_AK035849.1,GB_AB246391.1,
13+17dbEST_BB651018.1,dbEST_BB639977.1,dbEST_BY730666.1,dbEST_BB651093.1,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,GB_AK042773.1,GB_AK164676.1,GB_AK082508.1,
34+14dbEST_BB651018.1,ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,GB_AK042773.1,GB_AK164676.1,GB_AK082508.1,
45+11ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,ENSMUST00000162637,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,GB_AK042773.1,GB_AK164676.1,
56+9ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,ENSMUST00000162637,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,GB_AK042773.1,
67+9ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,ENSMUST00000162637,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,GB_AK042773.1,
78+9ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,ENSMUST00000162637,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,GB_AK042773.1,
89+12dbEST_BG803882.1,dbEST_BB248113.2,ENSMUST00000161356,ENSMUST00000062372,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,GB_AK042773.1,
910+7ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,
911+2dbEST_BG803882.1,ENSMUST00000162876,
1011+7ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,
1112+9dbEST_BG803882.1,ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,
1213+9dbEST_BG803882.1,ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,
1314+7ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,
1415+7ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,
1516+7ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,
1617+10dbEST_BQ942386.1,dbEST_CF982298.1,ENSMUST00000161356,ENSMUST00000062372,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,
1718+8dbEST_BQ942386.1,ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,
1819+8dbEST_BQ942386.1,ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,
1920+8dbEST_BQ942386.1,ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,
2021+8dbEST_BQ942386.1,ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,REF_NM_011261.2,GB_U24703.1,GB_AK082447.1,
2122+8ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AY704216.1,GB_AK082447.1,
2223+8ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AY704216.1,GB_AK082447.1,
2324+8ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AY704216.1,GB_AK082447.1,
2425+8ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000162427,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AY704216.1,GB_AK082447.1,
2526+11dbEST_BB650292.1,ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000161353,REF_NM_011261.2,GB_U24703.1,GB_AK082689.1,GB_AY704216.1,GB_AK082447.1,
2627+9dbEST_BB650292.1,ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000161353,REF_NM_011261.2,GB_U24703.1,GB_AK082689.1,GB_AY704216.1,
2728+9dbEST_BB650292.1,ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000161353,REF_NM_011261.2,GB_U24703.1,GB_AK082689.1,GB_AY704216.1,
2829+8ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000161353,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AK082689.1,GB_AY704216.1,
2930+7ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000161353,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AY704216.1,
3031+8ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000161353,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AK082689.1,GB_AY704216.1,
3132+8ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000161353,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AK082689.1,GB_AY704216.1,
3233+8ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000161353,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AK082689.1,GB_AY704216.1,
3334+8ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000161353,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AK082689.1,GB_AY704216.1,
3435+7ENSMUST00000161356,ENSMUST00000062372,ENSMUST00000161353,ENSMUST00000115152,REF_NM_011261.2,GB_U24703.1,GB_AK082689.1,
3536+12dbEST_CF745458.1,dbEST_CD350969.1,dbEST_CF538774.1,dbEST_BB394258.2,REF_NM_011261.2,GB_U24703.1,GB_AK082689.1,
3637+12dbEST_CF745458.1,dbEST_CD350969.1,dbEST_CV555591.1,dbEST_CF538774.1,REF_NM_011261.2,GB_U24703.1,GB_AK082689.1,
3738+10dbEST_CF746249.1,dbEST_CF745458.1,dbEST_CD350969.1,dbEST_CV555591.1,REF_NM_011261.2,GB_U24703.1,
3839+10dbEST_CF746249.1,dbEST_CF745458.1,dbEST_CD350969.1,dbEST_CV555591.1,REF_NM_011261.2,GB_U24703.1,
3940+9dbEST_CF182433.1,dbEST_CF746249.1,dbEST_CF745458.1,dbEST_CD350969.1,REF_NM_011261.2,GB_U24703.1,
4041+10dbEST_CB246159.1,dbEST_CF182529.1,dbEST_CA752482.1,dbEST_CF182433.1,REF_NM_011261.2,GB_U24703.1,
4142+12dbEST_CD351286.1,dbEST_CD803434.1,dbEST_CB246159.1,dbEST_CF182529.1,REF_NM_011261.2,GB_U24703.1,
4243+11dbEST_CD351286.1,dbEST_CV560104.1,dbEST_CD803434.1,dbEST_CB246159.1,REF_NM_011261.2,GB_U24703.1,
4344+16dbEST_CA945564.1,dbEST_CB526578.1,dbEST_BU058431.1,dbEST_CV555803.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,
4445+18dbEST_CB723229.1,dbEST_BU055495.1,dbEST_CA945564.1,dbEST_CB522092.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,
4546+18dbEST_BQ444265.1,dbEST_CF534272.1,dbEST_CN525232.1,dbEST_CB723229.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,
4647+23dbEST_CV556538.1,dbEST_CF535508.1,dbEST_CV557598.1,dbEST_BQ180824.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,
4748+25dbEST_CN461773.1,dbEST_BQ771419.1,dbEST_CB527518.1,dbEST_CB526686.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,
4849+28dbEST_BI739930.1,dbEST_CA327105.1,dbEST_BQ769321.1,dbEST_CN461773.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_AK047608.1,
4950+28dbEST_CA327519.1,dbEST_BI739930.1,dbEST_CA327105.1,dbEST_BQ769321.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK047608.1,
5051+23dbEST_BU703528.1,dbEST_CA327519.1,dbEST_BI739930.1,dbEST_CA327105.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK047608.1,
5152+11dbEST_CB525595.1,dbEST_CN525156.1,ENSMUST00000161356,ENSMUST00000062372,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK047608.1,
5253+16dbEST_BU057535.1,dbEST_BU702681.1,dbEST_BI739276.1,dbEST_BM946999.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK047608.1,
5354+16dbEST_CA320866.1,dbEST_CA317283.1,dbEST_BU057535.1,dbEST_BU702681.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK047608.1,
5455+16dbEST_CA320866.1,dbEST_CA317283.1,dbEST_BU057535.1,dbEST_BU702681.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK047608.1,
5556+20dbEST_CA321167.1,dbEST_CA321202.1,dbEST_BU613704.1,dbEST_BI986963.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK047608.1,
5657+21dbEST_CF745088.1,dbEST_CA321167.1,dbEST_CD578712.1,dbEST_CA321202.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK047608.1,
5758+20dbEST_BY722844.1,dbEST_BY716108.1,dbEST_CN538668.1,dbEST_CF745088.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK047608.1,
5859+20dbEST_BU613041.1,dbEST_BY716773.1,dbEST_BY722844.1,dbEST_BY716108.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK017094.1,GB_AK047608.1,
5960+19dbEST_BU707004.1,dbEST_BU613041.1,dbEST_BY716773.1,dbEST_BY722844.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK017094.1,GB_AK047608.1,
6061+20dbEST_DV659067.1,dbEST_BU707004.1,dbEST_CD805586.1,dbEST_BU613041.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK017094.1,GB_AK047608.1,
6162+20dbEST_CF744531.1,dbEST_CF745741.1,dbEST_DV659067.1,dbEST_BU707004.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK017094.1,GB_AK047608.1,
6263+13dbEST_CO811628.2,dbEST_CF744531.1,dbEST_CF745741.1,dbEST_DV659067.1,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK017094.1,
6364+11dbEST_CO811628.2,dbEST_CF744531.1,dbEST_CF745741.1,ENSMUST00000161356,REF_NM_011261.2,GB_U24703.1,GB_D63520.1,GB_BC118041.1,GB_AK017094.1,
6465+2dbEST_CV556716.1,ENSMUST00000160791,
6466+4dbEST_CO811628.2,ENSMUST00000062372,GB_BC118041.1,GB_AK017094.1,
6566+2dbEST_CV556716.1,ENSMUST00000160791,