NIA Mouse Gene Index (mm92)

Exon structure for U026131

chr5 -

Exon1 38108396 - 38107974
	cctcctttttcctcaccaccGTTGTGAGCAGAGCTGCACGGTGGTCTGGGCTCAGGGAGTCCCCGGGTTTCCATCCGTGTATTGTGCGTCATGGAGAGAA
	TCGGGTGAGGGCTCAGGGGGTGCGGTGATCGCAGCGGGGTGACACCCTGGAGGAGGGGTGACCACACGGTCCCCATCCCTGCCCTGCAATCGGCCCCCTC
	CACACACGCTACAACCCTGGCTGGCTGCTCTCACCCAGGCTGCATCCCAGGGCTCTCATCCTGCACACTGCATCCCAAGAGCATCCTGGATCCCGTATCG
	CTGTGAGAATCCTGCATCTGACATCCCGAAAGGAGAGGCCGGGCATGTAGTAGCGGCAGTAGCGGCGGAATATGGGCGGGAACCACTCCCACAAGCCCCC
	AGTGTTTGATGAGAACGAAGAAG
Exon2 38040385 - 38040330
	TCAACTTTGACCACTTCCAGATCCTGCGGGCCATTGGGAAAGGAAGTTTTGGAAAG
Exon3 38020249 - 38020098
	GTATGCATCGTGCAGAAGCGAGACACAAAGAAGATGTATGCCATGAAGTACATGAACAAGCAAAAGTGTGTGGAGAGGGATGAGGTGCGGAACGTGTTCC
	GGGAGCTGCAGATCATGCAGGGATTAGAGCACCCCTTCCTGGTGAACCTATG
Exon4 37922957 - 37922784
	GTACTCCTTCCAGGATGAGGAAGACATGTTCATGGTGGTGGACCTGCTGCTGGGTGGGGACCTGCGCTACCACCTACAGCAGAATGTGCACTTCACAGAG
	GGGACCGTGAAGCTGTACATCTGTGAGCTGGCCCTGGCTCTGGAGTACCTGCAGAGGTACCACATCATCCACAG
Exon5 37890265 - 37890228
	AGACATCAAGCCAGACAACATCCTACTGGATGAGCATG
Exon6 37881789 - 37881700
	GGCACGTGCACATAACGGACTTCAACATCGCCACGGTCCTGAAAGGAAGTGAGAAGGCTTCCTCCATGGCTGGCACGAAGCCCTACATGG
Exon7 37858078 - 37857975
	CCCCTGAAGTCTTCCAGGTGTATGTGGATGGAGGCCCTGGGTACTCATACCCCGTGGACTGGTGGTCACTGGGTGTCACAGCCTATGAGCTGCTCCGAGG
	CTGG
Exon8 37852705 - 37852589
	AGGCCATATGAGATCCACTCAGCCACACCCATTGATGAGATTCTCAACATGTTCAAGGTGGAGCGTGTCCACTACTCCTCCACGTGGTGTGAGGGGATGG
	TGTCCCTGCTGAAGAAG
Exon9 37850966 - 37850841
	CTGCTGACCAAGGACCCTGAGAGCCGCTTGTCAAGTCTTCGTGACATCCAGAGCATGACCTACCTGGCTGACATGAACTGGGATGCAGTATTCGAGAAGG
	CCCTGATGCCTGGCTTTGTGCCCAAT
Exon10 37848492 - 37848361
	AAAGGGAGACTGAACTGTGACCCCACATTTGAACTTGAAGAAATGATTCTAGAATCCAAGCCACTTCACAAAAAGAAGAAGAGGTTGGCCAAGCATAGGT
	CCAGAGACAGCACAAAGGACAGCTGTCCCCTG
Exon11 37846238 - 37846174
	AATGGACACCTGCAGCAGTGTTTGGAGACAGTGCGGAAAGAGTTCATCATATTCAACCGAGAGAA
Exon12 37840030 - 37838055
	ACTCAGGAGGCAGCAGGGACATAATGGCCAACTCTCAGACCTGGATGGCCGAATAGGAAGCCAGACCTCAAGCAAGCTGCAGGATGGTCGAAACAATAAC
	ATCCTGACCCATACATGCCCCCGAGGCTGCAGCAGCTAAACTCGACTGCCCAGATGACACTGTCTGCCCTGACACCCAGAACCCCCCTGTCCCCTGATGG
	ACCCCATCTCACCCCTAAAACATCAGATGcaggaagagctctgtattcagggttctggtccttgtttccagctgattcgctgtgtgaccttgagcaaatc
	acacattctctgtgcctcagttttctgcatctgtggaaggggttaaacagctctttgccccatctccagtcataaaattgtgagaatctggttggactgc
	agatatgtaaactcctgggcattgatcaagtgtttatacatgtaaATTATCTCAATATCTAAAGTGTCCTCCCTAGCCCCCACACAATTTTAACCATGAG
	AACTTTGCAATTTGGCCCATCCTAGTTTGCTTGATGGAACTTTCAACAACATAAATAGCTGATATGTTTGTCCCTCTTATGGGACTTCCAGGTTCCAAAG
	CAACCAGGAAGAGTCACACACAGACTTCCTGGCCTTCTGGAATGGTGCAGCATAAAGACCAAGCCCAGGAGTTTCTGCTGCAAACAGGTTTTTCCCTGAC
	TCGTGGAAGGCTGCCCCCACATTTGGATTCCAGCAATCACCAGCTATCACCATATCCCCACATCCCCGTGTTAGATGGCACTGTGTCTCTGGCCACTCCT
	CCCCACCACAGAGTGTCCTGGGATCCCAGAGGAGACTCATCCTGCAGCGTGACCTCAGTCCCCACCAGGAAGAATATAAGAGTCCAGTCAGCCTGTCATG
	CAAAGGCTCCCTGGCTGGGTAGTCAGAGCTTCCTGTTGATACCTTAGGAAGCCTCGGTGCTTAGAGTCTTCTGTAGACACAAGCAGAATCACTCAAGAAG
	CCAAGTATCTTATACCCTGGCCAGGAACCAGCTGACCCTTGAGCTGAGGATGCTGAGATTAGCAAAGAAAGCCAGTTGGCAGCTGCAGCCAAGACTGGAA
	GACCTCTGCAAATCATGTGCTTGCTCAAAGGTCAATTTTCTCATTCTCAAAAAAGGAAGGAGAAGGATGGCCTTGTTATGGGACTTGATAAGATCCCATG
	TGTCACACAGTGATGACTGACGTTGGCCATCACcctcctcatcatcatctccctcctcttcctcctcctcctcctcatctccctcctcttcttcttcctc
	ctcctcctcctcatctccctcctcttcttcttcctcctcttcctcctccctcttctctaccctccccctactcttcctcctcctcATATTTATCATCATC
	ACCACCATCATGACTGCAATCCTCCTCTGTTGGAGGTACTTTCCTGTTTTGGTGACATAGCAGGTCTGATTTCTGTGGACCAAGGATCCTCCAAGTTTAC
	AGTTTGTTTTCTTTTCTTACCTGGAGCCTCTGAGGTCTGGACATCCCCGCTAAGAACATCCCTACTGAGATCAAGTGTTTTCACGTCAGCCTCTGTTTCC
	ATTTTCCACTTTCTCACTATGATTCACGTCTATCAGTGTCATCTCTTAGATCTCTTGAGAGACATTTTAATGTATGGTAAGGTTTTACACTTTTCAAATA
	ACTGCATTGTACCACCCCCTTAACTGAGTCCCCCCACCATGTCTATCTCCTGCCCACTGTACTGTCTCCAGCCCCTGTCTGCCCTTCCTGCCCTGCAGAA
	CATCCAGCCGATCTTCTCTACACTGTGACCTAGAAGTATCATAATGTCTTCTTGGCATGAGCTTGTGAATGAGAGGAGGTGGTGAAGGGGAGGTGCACGG
	TGGGGACCCTGATTATTTGGCTCTGTTTAAGTCCATGTTCCTTGTTCAGAATAAATAAGCACTCAGATGTTCCTTG

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+16dbEST_CF736437.1,dbEST_BQ571307.1,dbEST_CB520836.1,dbEST_CN460405.1,REF_NM_022416.2,GB_BC052404.1,GB_BC058412.1,GB_BC056396.1,GB_AK082468.1,GB_AJ250840.1,
23+18dbEST_CA320851.1,dbEST_BQ044851.1,dbEST_CF736437.1,dbEST_BQ571307.1,REF_NM_022416.2,GB_BC052404.1,GB_BC058412.1,GB_BC056396.1,GB_AK082468.1,GB_AJ250840.1,
34+16dbEST_CA320851.1,dbEST_W65887.1,dbEST_AI430616.1,dbEST_BQ044851.1,REF_NM_022416.2,GB_BC052404.1,GB_BC058412.1,GB_BC056396.1,GB_AK082468.1,GB_AJ250840.1,
45+15dbEST_CD578874.1,dbEST_BM934086.1,dbEST_CA320851.1,dbEST_W65887.1,REF_NM_022416.2,GB_BC052404.1,GB_BC058412.1,GB_BC056396.1,GB_AK082468.1,GB_AJ250840.1,
56+14dbEST_CD578874.1,dbEST_BM934086.1,dbEST_CA320851.1,dbEST_W65887.1,REF_NM_022416.2,GB_BC052404.1,GB_BC058412.1,GB_BC056396.1,GB_AK082468.1,GB_AJ250840.1,
67+12dbEST_CD578874.1,dbEST_BM934086.1,dbEST_CA320851.1,dbEST_W65887.1,REF_NM_022416.2,GB_BC052404.1,GB_BC058412.1,GB_BC056396.1,GB_AK082468.1,GB_AJ250840.1,
78+10dbEST_CD578874.1,dbEST_BM934086.1,dbEST_CA320851.1,ENSMUST00000094836,REF_NM_022416.2,GB_BC052404.1,GB_BC058412.1,GB_BC056396.1,GB_AK082468.1,GB_AJ250840.1,
89+9dbEST_CD578874.1,dbEST_BM934086.1,ENSMUST00000094836,REF_NM_022416.2,GB_BC052404.1,GB_BC058412.1,GB_BC056396.1,GB_AK082468.1,GB_AJ250840.1,
910+9dbEST_CD805784.1,dbEST_CD578874.1,ENSMUST00000094836,REF_NM_022416.2,GB_BC052404.1,GB_BC058412.1,GB_BC056396.1,GB_AK082468.1,GB_AJ250840.1,
1011+10dbEST_CD354698.1,dbEST_CD805784.1,dbEST_CD578874.1,ENSMUST00000094836,REF_NM_022416.2,GB_BC052404.1,GB_BC058412.1,GB_BC056396.1,GB_AK082468.1,GB_AJ250840.1,
1112+10dbEST_CD354698.1,dbEST_CD805784.1,dbEST_BF461415.1,ENSMUST00000094836,REF_NM_022416.2,GB_BC052404.1,GB_BC058412.1,GB_BC056396.1,GB_AK082468.1,GB_AJ250840.1,