NIA Mouse Gene Index (mm92)

Exon structure for U026326

chr5 -

Exon1 77334539 - 77334448
	GGGCGCCCGAAGATGACGCAGAGGTCCGTTTTACGGCTGCTGAGCGTCTGCGGCTGGGCTAGGAAGTGCACGCCACGCGCTGTCGTGAGAAG
Exon2 77334415 - 77334296
	ACTTTGTGAGCTGCCGGACCCCAGCTTGGAGCGGCTGTGTGGGTCACCTCGGTCACCTGCTGCGCCACCTCTTAGCGTGGTTCCGAGAGCCAACGAGAGG
	CTTTTGTGATTGTAATTAAG
Exon3 77334037 - 77333984
	catggtgaagaaacaaaaaggacctttcggaagtgggttctctccttccattat
Exon4a 77333405 - 77333283
	gtatagcagtgttttacctgcatgtatgtaagtgcaccatgttcgtgcctggtgtcttcaaaggctgtgggatcagccagaactggaactatggactgta
	ttgagctccccagttgggtgctg
Exon4b 77333282 - 77333234
	gtatggaatctgtgtcttctgaaagaacaaggacggtttaactcctgag
Exon5 77331210 - 77330943
	ATTTCTCAGCCACCAATGTTTAGACAAACCTCAATAAAATGACTCTTCAGGAGTTGGTGCTTCGGACTGCCTCTGTCTATATGGATAGAACAGCTGTATG
	TTTTGACGAAGGCAATAACCAGCCTCCAGTGTGCTATTCCTACAAGGCTCTGTTGAGCGCGGCTTCAGAATTATCCCATTTTCTGATAGCACACTGTGAC
	TTTGGAGGAATTCGGGAAATTGGTCTCTATTGTCAACCTGGGATAAACTTACCCTCCTGGATTTTAGG
Exon6 77330306 - 77330186
	GATTCTTCAGGTCCCCGCAGCGTATGCGCCCATTGATCCAGACTCCCCACCGTCCTTATCAACTTACTTTATGAAAAAATGTGACCTAAAGTATGTTCTC
	GTTGAAAAACAGCAGCTTAGT
Exon7a 77325715 - 77325557
	AAATTCAAATCTTCACATGAGACAGTTCTGAACTATGACACAGTTTCCGTGGAACACAAGGACCTGGCACTCTTCAGACTGCATTGGGAAGATGGTCGGG
	TGAGCACAGTGCTTGGTGACAGAGCAGATCAGCACAAGGTGACGGATAGAGAAGACAGA
Exon7b 77325556 - 77325402
	GTGAGTGCTGAGAGCAGGACCCCAGAGAAGGAGCACATGGACATGCGGCATGACGGTTGCTTGGCTTATGTCCTCCATACCTCAGGGACCACGGGGACAC
	CGAAGATTGTCAGAGTGCCCCATGCATGCATACTGCCTAATATCCAGCACTTCCG
Exon8 77323507 - 77323475
	TATATAAGCATGCTTCctacacagagggatccc
Exon9 77323387 - 77323315
	GAAACCAGACGGTATATATGAAGAACAATTCCATTAAAAATGAAGTTTGGGCCATCCATTATGAGAGTCACAG
Exon10 77320820 - 77320628
	GTCACTTTTTGACATCACTCAAGAAGACATTTTGTTTCTGGCTTCTCCTCTGACCTTCGATCCATCTGTTGTGGAGATATTTGTTTCTCTGTCCAGTGGG
	GCCTGCCTGCTTATCGTGCCAACTTCTGTCAAAGTGCTACCATCAAAATTAGCTGACATTCTCTTTTCCCGCCACAGAGTGACTGTTTTACAG
Exon11a 77317859 - 77317618
	GCAACGCCAACATTGCTGAGAAGATTTGGATCTGAGCTCATCAAGTCCACTGTCCTGTCAGCGCATACGTCTCTGAGAGTCCTGGCCCTCGGTGGGGAAG
	CCTTCCCCTCGCTGACCATCCTCAAAAGCTGGCGAGGCAAAGGCAACAGAACCCAGATATTTAACATCTATGGTATCACAGAGGTATCCAGCTGGGCCAC
	TTTTTACAGGATCCCAGAGGAGATTCTTAATTCTGCCGTGAA
Retained Intron 77317617 - 77317162
	GTAAGGGCTTTAGTTATGCTCAGTAGAGGGGTGCAAGGATAGGGGCTGTCCCTTTCTGAGACCTTAGCACTAATGCTGGGGGGAGTGACTTTTGTTTGGG
	GTGGCAGTTGAGCATGGTGGCTGTACAAGTCATGTCCTTGCGTAGGAAGCACACTCTTGCCTGGGAGCCGTGCTCCTAACCCGGCTAATGGGTTTGTCAG
	GCGCTGTCCTGATATTTTATCTAGTGGTACAAGTTAAGAATCTAAATCTTTCCTGTAACTCATCTCGAGATCCTGGCAGACCCTCTTGGGACTGAATTGG
	TAACACATCCCTTTCTGCCAGACTTGTTCCTCATGCAGTCTTTGAATTGTACGGTAAACTGTTTTGTCTTTATTTGCTATAGTATAATTTTAATACACTG
	GGAAATCGCCTGCTCAAATGAAAATCTTAAACTTGCTCTGGGTGTGTTTTTTGCAG
Exon12 77317161 - 77317055
	ACATGAATCCCCTGTGCAGCTGGGGTCGCCACTACTTGGAACGGTGATTGAAGTCAGAGACCAAAATGGTTCTCCAGTTCTCGAAGGCACTGGCCAAGTA
	TTTTTAG
Exon13 77316385 - 77316213
	GTGGGAAGAACAGAGTGTGTTTTCTTGATGATGAAATGACAGTGCCCCTTGGCACCATGAGAGCCACAGGAGACTTTGTGACTGTGAAAGATGGAGAGAT
	ATTTTTCTTGGGAAGAAAGGACAGCCAGATCAAGCGCCATGGCAAACGTCTTAACATTGCACTTGTGCAACAG
Exon14a 77315347 - 77315155
	GTTGCTGAAGAACTTCGCCAGGTGGAGTCCTGCGCGGTCACTTGGTATAATCAGGAAAGATTGATTCTCTTCATCGTATCCAAAGTTGACTTAGTAAAGG
	ACTGCATCTTTAAAGAATTGCAGAAACACCTTCCAGCACACGCCCTGCCTGATGACATGGTGCTGATCGATACCCTGCCATTTACATGCCATG
Exon14b 77315154 - 77315072
	GTAAAGCGACAAAGCGGTGTGGGGTGCTCAGTGCTGGAGAGCACTAATGGTGCTCGTTGGTCAATGGCTGCAGAAGGACTATT
Exon15 77313226 - 77313111
	GCAAAGTTGATGTTTCTGAGTTAAACAAGATATATTTAGACTACATAAGCTCACAGCCTAGGAATGAACTCCATGGAAAAGAGGAACTTTGGGGAAAATT
	ACAGTATTTATGGAAG
Exon16 77312087 - 77311292
	TCTATTCTGTGTCTCCCTGAGGATCCAGAGGATACTCTGAAGGTTCCCGCCAACTCCGTCTTTTTAGATAGTGGTGGGGATTCCCTCAAGTCCATGCGGC
	TCCTCAGTGAGATTGAGAGGCTCACCGGGACAGCCATCCCTGGCCTTCTGGAAGTTATCCTCAGCAGTTCCCTCTTAGACGTTTACAACCACATCGTTCA
	AGCCGTGTTCACACCGGAGGACAGGAAAGCCAACAGGAGTTACACCACAAAAAGGAAATTCAGTGATGCTGATCCAGAGGAAGCCAGCGGGAAGCCTGCA
	CGTCTGGAGTCTGCCTGGCCTTCGAACCATGCCGGCGAGACCAACTCCGTGATCGCTCTGAGCAGAGGGAGTCAGGTTTTGTCTCTTGGCGCTGGGAGGC
	TTTTAACTCAGTTAGGACTCTGCCTGCCAGTCTGTTCTCTGGATTTAATCCCACAGACTAACACTCAGATATTAAAAAGCCTAAGTCCTCCAGCTCCTGA
	TGAAAACTTGGAAAAGCCCCCACTTTTTCAGCAGGGGAGCCCCGTGGTTGGGGCTATGGCGATGGCATTGCGGGAGAGGTGGCGGTCAGACACAGGCAAA
	TGCGTTGATGCCTCCCCTCTGCTGGTGAGAGCGGCTGTACAGGATAAGCCCTCCACAACCGTGTATATTGGCTCGCACTCGCACACAGTGAAGGCTGTCG
	ACCTGTCCTCTGGGGAGACGAGGTGGGAACAGCTTCTGGGAGATCGAATTGAATCCTCAGCGTGTGTGTCTAAATGTGGAAACTTTATTGTAGTGG
Exon17 77309098 - 77308935
	GCTGTTATAATGGATTAGTCTATGTCCTAAAAAGTAATAGTGGAGAAAAATATTGGACATTTACTACTGAAGATGCTGTCAAAAGCTCACCAGCCGTGGA
	TCCAACCACAGGACTCATTTATGTCGGATCTCATGACCAGCACGCATATGCTTTAGACATTTAT
Exon18 77307551 - 77307429
	GAAAAGAAATGTGTCTGGAAGCTAAACTGTGAAGGCGCTCTCTTTTCCTCTCCGTGTGTGAGCCTGAGTCCACACCATCTGTACTGTGCTACGCTAGGGG
	GACTCTTACTGGCCCTAAATCCT
Exon19 77306683 - 77306552
	GCTTCTGGGAGCACGGTGTGGAAGCGCTCCTGTGGAAAGCCACTCTTCTCTTCCCCACGGTGCTACCAGCAATACATCTGCATCGGCTGCGTGGACGGCA
	GTTTGCTCTGTTTCACACACTCAGGGGAGCAG
Exon20a 77305703 - 77305693
	TGTCTCTGAAC
Exon20b 77305692 - 77305567
	ATACCAGGATGAACCAAGTATGCTCAAGGTTCATTGTAGTCATGCTCTGCTGTGCCTGATCCTGGCTTTTACCACTGGAGCAGTTCCGTGTGAGAGCGCT
	ACTTCCCAGAGAGGGCGCCATTTCTG
Exon20c 77305566 - 77305485
	GTGTGTGAGTTACCGAGCGCTCTCCATCTCACCTCTGCCATCTGGATGAAGAGACCCCGTTGGACTCAAGAGTTGCGGTCAG
Exon21 77305447 - 77304960
	GTCTGGCGCTTTGCTGCTGGAGGGCCAATCTTCTCATCCCCATGCGTCTCGGCAGCAGAACAAGAAATATTTTTTGGTTCCCATGACTGCTTTATCTACT
	GCTGTAGCAAGGAAGGTCACCTCCGGTGGAAATTTGAGACGACAGCCAGGGTGTATGCAACGCCCTTTGCTTTCAGTAACCACCCCCGTAGCGATGATGC
	ACTGCTGGCAGCGGCATCCACTGACGGGAAACTGTGGGTCCTCGAGTCTCGGAGCGGAGAGCTGCGAAGTGTGTATGAACTCCCCGGAGAAGTCTTCTCC
	TCTCCTGTGGTCTGGGAATCAATGCTTGTTATTGGGTGCAGAAACAATTATATTTACTGTCTGGATTTATTGTGTGGTGATAAAAATAACCAGGTGTAGT
	CCTTGTAAGTATGTCAGTGAGAGGGTTGGAAATGTCATTGTAAAGCCTATGGATGGGTTTATATTAAAGATTCTATTTTGGTTAGGAA
Exon22 77303338 - 77302684
	aagtgcaccacacgtgccttccctccagagaccagaggagcacgtggggtcctctggggctggagtgagcaccatggagatgccaccagctgagcctgtg
	tcctctgaaggaagcaagagctctcaataaaccatccctctagACTGAGGTAAAGGTTTTTAAAGGTAGGATCTGTTTATCAACTTAGGTTCCTTCTTCT
	GGTGGGGAGAAGGGGGGTAGAAAACCAGTACAtgcattgctgggacttgaacccagggctttgttcatgctaggcaaacactccactactggactaGGTT
	CATGCCATTTCTAAGCAAtgcctatgttaatgcctatgttcgtgcctatgttAATCACACACTCAGGTCATCATTCCTTCTATGCAGCCCACACTGACTT
	TGAGTTTTTCACCAAGTTATTCTTGAAGGTCACATGCTCAGATGGGCCAAGGTGTAGCCTGGTGGTAGCCGGTCCTCAGCTGCACTGCTCACAAGTCCCC
	GGCTGAGACTACAGTAAGGAGACTGCAAGATCATTTTAACCAAGACTCAGATCTCTATCTTCCAGTTTGGAATTGATATAAATATTTGCCATCCTTATCA
	TATATTCTTCCACTGGGATTTTTGGGTGAAAAAAATAAAGTAGCGTTAAAAACAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+22dbEST_BB632053.1,dbEST_BY260614.1,dbEST_BY062163.1,dbEST_CJ074408.1,GB_AK038779.1,
34a+23dbEST_BB632053.1,dbEST_BY260614.1,dbEST_BY062163.1,dbEST_CJ074408.1,GB_AK038779.1,
24a+2dbEST_CB192994.1,ENSMUST00000135954,
14a+18dbEST_BY741513.1,dbEST_BY741533.1,dbEST_BY721311.1,dbEST_BB641611.1,REF_NM_173765.3,GB_AK136849.1,GB_AB095954.1,GB_AK148405.1,GB_AK043807.1,GB_AK217387.1,
15+5dbEST_BQ888709.1,dbEST_BB665556.1,ENSMUST00000135697,ENSMUST00000136080,GB_BC094507.1,
4a5+3dbEST_BY098638.1,dbEST_BY085588.1,ENSMUST00000142450,
4b5+42dbEST_CA326572.1,dbEST_BY741513.1,dbEST_BY741533.1,dbEST_BY721311.1,REF_NM_173765.3,GB_BC058102.1,GB_AK136849.1,GB_AB095954.1,GB_AK148405.1,GB_BC128330.1,GB_AK038779.1,GB_AK043807.1,GB_AK217387.1,
56+24dbEST_CA326572.1,dbEST_BB665556.1,dbEST_BY741513.1,dbEST_BY741533.1,REF_NM_173765.3,GB_BC058102.1,GB_AK136849.1,GB_AB095954.1,GB_AK148405.1,GB_BC128330.1,GB_BC094507.1,GB_AK038779.1,GB_AK043807.1,
67a+22dbEST_BB268460.2,dbEST_BQ888709.1,dbEST_CA326572.1,dbEST_BB665556.1,REF_NM_173765.3,GB_BC058102.1,GB_AK136849.1,GB_AB095954.1,GB_AK148405.1,GB_BC128330.1,GB_BC094507.1,GB_AK038779.1,GB_AK043807.1,
7a8+1ENSMUST00000136080,
7b9+2ENSMUST00000123682,GB_BC058102.1,
7b10+12ENSMUST00000120963,ENSMUST00000126741,ENSMUST00000135697,ENSMUST00000146570,REF_NM_173765.3,GB_AK136849.1,GB_AB095954.1,GB_AK148405.1,GB_BC128330.1,GB_BC094507.1,GB_AK038779.1,
910+2ENSMUST00000123682,GB_BC058102.1,
1011a+14ENSMUST00000123682,ENSMUST00000120963,ENSMUST00000126741,ENSMUST00000135697,REF_NM_173765.3,GB_BC058102.1,GB_AK136849.1,GB_AB095954.1,GB_AK148405.1,GB_BC128330.1,GB_BC094507.1,GB_AK038779.1,
11a12+13ENSMUST00000123682,ENSMUST00000120963,ENSMUST00000126741,ENSMUST00000146570,REF_NM_173765.3,GB_BC058102.1,GB_AK136849.1,GB_AB095954.1,GB_AK148405.1,GB_BC128330.1,GB_AK038779.1,GB_AK194577.1,
1213+13ENSMUST00000123682,ENSMUST00000120963,ENSMUST00000135697,ENSMUST00000146570,REF_NM_173765.3,GB_BC058102.1,GB_AK136849.1,GB_AB095954.1,GB_BC128330.1,GB_BC094507.1,GB_AK038779.1,GB_AK194577.1,
1214a+2ENSMUST00000126741,GB_AK148405.1,
1314a+14dbEST_BB176569.2,ENSMUST00000123682,ENSMUST00000120963,ENSMUST00000135697,REF_NM_173765.3,GB_BC058102.1,GB_AK136849.1,GB_AB095954.1,GB_BC128330.1,GB_BC094507.1,GB_AK038779.1,GB_AK194577.1,
14a15+15dbEST_BB176569.2,ENSMUST00000123682,ENSMUST00000120963,ENSMUST00000126741,REF_NM_173765.3,GB_BC058102.1,GB_AK136849.1,GB_AB095954.1,GB_AK148405.1,GB_BC128330.1,GB_AK038779.1,GB_AK215879.1,GB_AK218868.1,
14b15+2ENSMUST00000135697,GB_BC094507.1,
1516+18dbEST_CA750147.1,dbEST_BB176569.2,dbEST_BE372193.1,ENSMUST00000123682,REF_NM_173765.3,GB_BC058102.1,GB_AK136849.1,GB_AB095954.1,GB_AK148405.1,GB_BC128330.1,GB_BC094507.1,GB_AK038779.1,
1617+22dbEST_CN712060.1,dbEST_CA566318.1,dbEST_CF898063.1,dbEST_CD555215.1,REF_NM_173765.3,GB_BC058102.1,GB_AK136849.1,GB_AB095954.1,GB_AK148405.1,GB_BC128330.1,GB_BC094507.1,GB_AK215263.1,
1718+19dbEST_CN712060.1,dbEST_CA566318.1,dbEST_CF898063.1,dbEST_CD555215.1,REF_NM_173765.3,GB_BC058102.1,GB_AK136849.1,GB_AB095954.1,GB_AK148405.1,GB_BC128330.1,
1819+16dbEST_CA566318.1,dbEST_CF898063.1,dbEST_CD555215.1,ENSMUST00000123682,REF_NM_173765.3,GB_BC058102.1,GB_AK136849.1,GB_AB095954.1,GB_AK148405.1,GB_BC128330.1,
1920a+2ENSMUST00000123682,GB_BC058102.1,
1821+3dbEST_CN712060.1,ENSMUST00000149602,NIA_E0602C04-5,
20b21+2dbEST_BU961768.1,ENSMUST00000145022,
1921+15dbEST_BY479090.1,dbEST_BM234430.2,dbEST_BB760971.1,dbEST_BB771738.1,REF_NM_173765.3,GB_AK136849.1,GB_AB095954.1,GB_AK148405.1,GB_BC128330.1,
20c22+2ENSMUST00000123682,GB_BC058102.1,