NIA Mouse Gene Index (mm92)

Exon structure for U026509

chr5 -

Exon1a 107125849 - 107125584
	GTTTGGTTTTGGCACGGGAGAGCAGCGGTGCAGCGTTGCTGCCGCCCCCCGTGGGTCTGATTGGCACGGGAGCTCCGGCGGCCCGAGAGCACGGGCGCGC
	CTCGCTGGCTTCCCCCGGCGGCCGGCGGCCAGGCAGAGGCGGGAAAGCCGCGCGCCTGCGCCGTGGGAACCGAGGCCGGAGGCGAGAAGCGGGGAGCGGA
	GGGGGCCGTTGGAGCCGAGTAGCGTACAGAGCGGCGTGTGACGCGGGGACGCCGCGCGCTCCCAAC
Exon1b 107125583 - 107125551
	GTCGCCCCGGTTTGACGCACACGGCACCAAACT
Exon1c 107125550 - 107125253
	GTGAGTTTCGGGGGTCTTATTCGGTCGGATTAGCCCCGGCCCCGGCCGCGTTTCGGACGTCCGGGCTGAGGCGGTGGCGGGACTGAGGGTGGCGGAAGAA
	GTTGTGGGGGGACCCGGCCCGCGGCGCTCGGGCCCGGGGAGCTACGCCCTAGGCTGGCTCCCAACCCTCGGAAAGGACGCGTTTTGCCGCACAGGCTAAG
	ATGGCGGCTGCTGCCGAGGAGGCGGAGTTGCTGCTGCACAAGGAgcccgggccgcggggtccgggaggcggcggtcgcggggggccgcggAACCTTAG
Exon2 107125242 - 107124817
	gcggccgccgcggggcgggactcggaggcgggcgcgcggggcggggggTGCCTTTCCGCTGCGGCGGCGGCGGATCCGGTGGCGGACACAAAGGGGCCGA
	GCCGGGCTCTGGACTCGGGGGGTTTTGTTTAGTCACATGTAGCGGAGCAGCCAGTGAGCGGTAGGGGGAAGGGGGCCGAGACCCGGAGGTCCGGGGAGCC
	CTGCGGTCGCCATTGTAACTCCCCGAGTAACGGGGGCGGTCCGAGAGCAGTCAGGCGGCGCCCCGTGCGCGGCTAGGCTACTCTGTCCGGGCCTGTAGCC
	CCGGCCCTGGAGGTAACTGTCCACACCCCTCCCCTGACTTTGGGACCAGAGCGCATAGCCTTCCCCTTCTTCCCACTGGTCTGCAACATCTTGTGCCGCT
	AAGTGCCTGAGAAGTAACTCCAAGAG
Exon3a 107124718 - 107124662
	GTCTGATTCCCTGGCCTTTGTGTCCCTGGGAGCTTAATCTCTGCCAGAGGAAAGCAG
Exon3b 107124661 - 107124156
	GTGTGTGCTCCGTCCACTCCTCCCGAGAACATGAAGATGAGTTGTCCCAGACCCTTCCCCGTGATTGGAAACTTAGGTGGTTTCTTGTTGCGAGACTTCC
	ACAGACGACTCTCGTGTTGGGATCCATCCATGGTTTAGCGACATTAGTGGAAAAGTTCTCTTCAACTGTTAAAATAATACTGACTTAAATGTAGTTGTTA
	TAAAACTTTCGTATTAGCTTTCAAATTTTATGTGATAAAACTCAACGAGGGGATGCCCACGGCTTGTGGCCCTGAAATGATGTTGGTCCTGTTGTGTGCA
	CAAGTTAATTTCCACAGAAGTATCCAAACACCATCACGTGTTGTGGCCAGTCCTGACTGATGCCAAGTTTACTGCATCTGGGAGATGTGTTGGATTTGCC
	TTAATCGTGTTGTAGTTTAGTTAATTTTGGCCCCACGAAGGAAAGTGTTTCAGAACCTAAACAACTAAAGTTCCCCAGATCAAGAAAACCTGCTTCAGGG
	CCATGT
Exon4 107119896 - 107119690
	acagggtctcatgtcgtccatgctggagcccacttcatcatgtagctgagggcgaccttgaccttcctgctgccttccacgtgctgggaacaagtcttcc
	atcactcctggcctgaaacgttgcCTCTGATCCTAGCACCATCATAGAGTAATGAAATTCATATAAAGTGAAATTTGTCTATTATGTGTTTCTGTGATGC
	TAACGAG
Exon5 107111032 - 107110923
	TAGTGGCTGTCAGGATCCTATCCCAGATGCAAGACTGGAAAATTCCTCCTCCTCTAGCACACTGATGTGATAAAGAAAAAACAAATCTCCATTGATAACA
	GAAGACCCAG
Exon6 107108762 - 107108699
	GGTCAGCTCAAGAACCGTTGTGGTTGGAGAAAAGACTACCTACTACCTCCTGGTGGGTTTGGAG
Exon7 107096636 - 107096535
	tggtgtaaagtacatggaagaggaagcgcgtgcataggctgcacataaagactatgccattacatataagggatctgactgtcctcagaccttactatcc
	at
Exon8 107095864 - 107095804
	GCTTGATTTAAATTTGGATGAGATTATTCTTGCATCAAGATGTTAATAAGCCAAAATTTAG
Exon9a 107067654 - 107065436
	ACTAAAGGTGTTAAATGATCTTGCCAACAATATGGATGATTTGAAGATAAACACCGACATTACTGGTGCTAAAGAAGAACTCCAAGATGACAACAATTTT
	ATCTCTGAGAAAGACAGTGGAGTTCATAAACCAAAAGATTGTCAGACATCATTTCAGAAAAACAGTTCATTGACTCGATCTGAGGAATTGTCAGAGGATC
	AATCAGAACAAGCCTTAAGTGGAGGCCAGTCTGCTTTGTTTCTCCCTGCCAGCACTCCTGCTGTTCCTACTGAAAACTTTCCCTTGCCCACAGGAGCTGT
	TGTTAATGGACCAGTCTCATGCTCCTCCTCCACAAAGACTTCCAATATGAATGAAGGTAGTGTTTCATTAACCCCTGGACAGCCTGCAGATCAGCTAGCA
	GCAGAGTCTTGCTCCACTTTGAAGGCAGCAGCTGATCATCAGCTGTCTACACCACAAAAAGCAAGTCAACACCAAGTTCTGTTTTTGTTATCAGATGTAG
	CACATGCTAAGAATCCAACCCATTCCATTAAAAAAGTACCTACCTCTGCTTTAGTTGGTTGTGATGTTCAGAATTCAGTAGGGAATAACATGAAGTCAGA
	GAGCACTTTACTAAGTCAAGCAGAGGTGGGTCAGGGCGACGCCTCCACAGTGGTCAGAGACGACTGTGTCAGCGCGTTAGCAGTGATTTCCTCAGGTACA
	GACGAATTTAGGTCAGAAAATGATACAAACTGGGATCCCCAAAAAGAGTTCATTCAGTTTCTTATGACTAGTGAAGAGACGGTGGATAAGCCCCCAGCTC
	ATTCTAAAGTAGTAGGTCTAGAAAAAAAGAGAAAGAGAAAAATGGATGTGAGCAAGATCACTCGCTACACAGAGGACTGCTACAGTGACTCAGGCCGTGC
	ACCTGGAAAATCAAAAATTCTTCAGGTTGACTTTCTAGGGCAAAACGAGGAGATGCAAGCAATAGACTCACAGAACTACACATTATCAAAAGTGAAACCC
	GAGTCAGCTGGTGGAGACTTGGAGTCTGTGGACACTTTTCAGCATCTAGTTTATAACTCAGATAAATGTGGAGAGGATAATTCACCTGTTCATACTCGCA
	CTTTAATTTCAAATACCTTAAAAAAGAAATGTGAAGAGAGTGATCCTGAGTCACCTGTTGCTTTCAGTACTGAAGAGCCATCATTCTACCCCTGTACAAA
	GTGCAATGTGAATTTTAGGGAGAAAAAGCATCTCCACAGGCATATGATGTATCATTTAGATGGGAATAGTCACTTTCGCCACCTTAATGTCCCCAGGCCA
	TATGCTTGTAGAGAATGTGGACGGACATTTCGAGATCGTAATTCACTACTAAAGCATATGATCATTCACCAAGAAAGACGGCAGAAGCTGATGGAAGAGA
	TTCGTGAGCTGAAAGAGCTCCAGGATGAAGGCAGAAGTGCTCGACTCCAGTGCCCTCAGTGTGTGTTTGGTACCAATTGCCCTAAGACGTTTGTGCAACA
	TGCAAAAACCCATGAGAAAGACAAACGGTACTACTGCTGTGAGGAGTGTAACTTCATGGCAGTGACGGAGAATGAGCTGGAATGCCATAGGGGCATCGCC
	CACGGAGCAGCAGTGAAGTGTCCTGTTGTGAGTTCAGAAGTAACTCAGAGAAAAACACAAAAGAAGACTTCAGTGAAAGACTCTGTTATAGGATCATCCA
	AAAAACCTGCTACTTACCTATGTAAGATGTGTCCCTTCACTACTTCAGCCAGAAGTATTCTGAAGAAGCACACGGAGTATTTGCATTCCTCGGCGTGTGT
	TGACTCCTTTGGTAATCCACTGGGACTTGACAAAAGAAAAAATGACAGCCTCGAGGAGTCTGTAGATGTCGATAGCACCAAGTCATTAGCTAAGCAGCAG
	CCAAGTACATTTCCAAAGAACTCTGCTTTAAAACAGGATGCTAAACGGACATTTGGATCAAGCTCACAGTCAAGTAATTTTTCAAAATTTCATAAGCGGC
	CACATAGAATACAAAAAGCCCGGAAAAGCATTGCCCAATCTGGTGTAAATTCGTGCAGTCAAAACAAGTCTCCTCACAAGAACGTTATGGTTAAGAGCAG
	CACTGACCAACAACCAAAGTATTTCCATCAGGCCCCAAGAGAAAAACCTAACGCCAGGGCAGACAGCAGTTATTTATATAGACACAAGTATAACAACTAC
	CGGACGATCAGAAAATCAG
Retained Intron 107065435 - 107065343
	GTGACTCATACCCACTTCCTTTCAAAAAAGAGGTTAATTCATTAAACTCTTTACATCTATTTTCATCAAGTAACTCTCATAATTTTATTTCAG
Exon10 107065342 - 107064629
	ACCCTCATAATGCAGACACCAAAAGGCCAGAAAACGAGAAAGACCACAAGCGTGTAGCTGTGAAAAGAGTAGCTAAGGCCTCAAAGAAGGAAAGCTCTGC
	TGGAGAGGACTTGGATAGCTATCCCGACTTTCTGCATAAAATGACTGTTGTTGTTTTGCAAAAGCTTCATTCTGATAAGAAAGATAGTTACGAAACAGAA
	GATGACAGCTCCTGGGATAACGTTGAGTTAGGTGACTACACTACACAGGCCATGGAAGAAGAAGCCTACAGTGACCTTAGTCAAGAACATGTAAACTTAT
	TGCCCCTGTTTAAAAGCAAGATAGAGGGCCAGGGCCCTGGAGACAGTGCTGCCCTGAGTTACGATCAGAATGATGGCTTCTACTTTGAATATTATGAAGA
	CGGTGGCACTAACAGCTTTTTACAGGATATACATGATCCTCAGCATTTGGAAAACCCAGAAACGCCTTTGTCAAAGCATAGTTCTGTTTTTCATTGGACT
	GATTTGTCTCTTGAGAAGAAGTCATGTCCTTATTGCCCAGCAACATTTGAAACAGGTGTTGGGTTGTCAAATCATGTCCGAGGACATCTTCACAGAGCAG
	GATTGAGCTATGAAGCCCGTCATGTTGTATCACCAGAACAAATAGCCACAAGTGACAAGATGCAGCACTTCAAAAGAACTGGCAACGGGACGCCTGTGAA
	ACGAGTTAGAAAAG
Exon11 107064455 - 107063850
	CTATAGAGAAGTCTGAAACTACTTCCGAACATACTTGTCAGCTCTGTGGTGGTTGGTTTGACACAAAGATTGGGTTATCAAATCATGTCAGAGGCCATCT
	GAAAAGACTTGGGAAAACTAAATGGGATGCTCACAAATCTCCAATCTGTGTTCTGAATGAGATGATGCAAAACGAAGAGAAGTATGAAAAGATCCTGAAG
	GCGCTCAACAGTCGCCGCATTATCCCCAGACCGTTTGTAGCTCAGAAACTCTCCTCAGGCGATGACTTCCTATCTCACAATGTCTTACCTCTTGATGAAT
	ACCACAATGGCCTAAAGACAGAGGCTCTCTCAGTGTCTGCATCAGAGGAAGAAGGGCTGCATTTCTTAAGTGAGTGTGGTGAAAGAAAGCCTGAACTGCC
	CAGTGGGAGAAAGAACCAGTCTCTTACACTGATAGAACTTCTTAAAAGTAGAAGGCTAGGCGAAGAAAGGAATTCTGCAGTCTCTCCTCACAAGACCCAT
	AACCAGACAGCAAGAAAGAGATTTGTTCAGAAATGTGTTCTTCCATTAAACGAAGACAGTCCGTTGATCTATCAGCCACAAAAAATGGACTTGACTGTGC
	ACTCAG
Exon12 107053409 - 107053104
	gaacattggtagaaatatggacagaaaaagtcattgtgttgaaggctcaaacaaaaatgagaaaggaggtattggaagctaagtgtagagctcatcttgg
	ttacactgctgcgaagaattggctggaagtctgcgctgttggactttgtagaacacagaacGGAGGACTGGGCTGTCTGTCTGGTGCCTTACAGTTCCTG
	ACAGCAGTGTTAGGCAGCGGAGTATCCACCTCAGCTGCCATCATCTCTGAGAGGACCAACCACACTGCCTAGAGCTCCTTGAAATTAAAGTGAGGCTGGA
	TGGCAG
Exon13 107048661 - 107048559
	CCATAGATTGTAAGCAGAAGAAATCAAGGTCAAGATCTGGAAGCAAGAAGAAAATGCTAACGTTGCCTCATGGTGCTGACGAGGTTTACATTCTCCGATG
	CAG
Exon14 107047447 - 107045750
	GTTTTGTGGCCTAGTCTTTCGGGGACCATTGTCTGTTCAGGAAGACTGGATTAAGCACTTACAGCGTCACATTGTAAACGCTAATCTTCCACGGACTGGA
	GCTGGCATGGTGGAAGTCACATCACTACTTAAAAAGCCTGCCTCTATCACAGAAACGTCGTTTTCTTTACTAATGGCAGAAGCAGCATCATAGAACCAGG
	AATCCTTTTCAATAGCAAATTTAATTGGATGTAAATTTAAAATTTGTGTCTTTTTTTTGTAAGCCACATGAAAGTATCCATTATAAATACTAAAGTAGGA
	AGAATGAGGGACCGTAAATTAGAGTGGCATCGGAGCAAACAATACTTCAGACAAGACAGTAAGTAGTCATATATTTTATATAGGGTGGAGATGTGTTCTT
	AAGGTTTACTAAGTTTTGTTGGCTGAGTTTACTCAACTAAAGGTCCTACATCTGAGAGCCATTTGTAAAGTGTTGCACATGAATCCTTACAGACAGACTT
	ACTGAAAGATTATGTTCTCTACAGTGTTACCAGAATCAAGGCTCTGGTTTTTCCCCACACATAGAAAAATAAGAAATTATATTTTGTTGGTATGTATTTA
	GTGTTTTGTATAATACCAGGAACTGCTAACTAAATTTACTCAACTTAGGGCATTAAATATCATGTACTTCATAGTTTGAGACTGTTCCCTCAAATAGGGC
	AGAGTACTATTCTATCTAGATGTGTTAAGTGTTTTTTTAAAATCATAATGGAACGGTTTTTTTTtatatatatatacatatatatatatatataCTAAAA
	AGTTGGAGCGAGATTTGTTTAAACAAGTATTTCTAAAAGAAATATTGTACATAGTCCTGGAAATTATTTGTGGTAAGGAAATATTCTTTAATCCAGTTGC
	ATTTCTCAGACAATGAAGTGGTGCGTCCATGCTACCTCCTGCTTTGTCAACAAAGATGCTATTTACCCTTTCCATTTGTATCATAATAGATTTTAAAAAT
	CTAATGTTCTTTATTGCAAGACATACTTTTGTTAACAGATTTGTTTCTTTGTAACGTTTTCCATACGTTTGACATGCTTACAGGACAGGGTTGTCTTTAT
	TTAACATTGTAGAAATGTAATTAATAAACAAGGCTCACTACACAATTTAGAATAGGCTTTCTCATTTATATTCCAAATTTGATCATTTAGCAAAACTATT
	GATACACAAAATATTTCTACATATGAGAATGTTTACAATTTGAATTTTAGAAGTTGTTTTTGGATGTGATTCTATGTATGAAAATTGTGTAACACTATGC
	TCATGCTAAGAACCGACTTAACAGAATTACTGAAATAAATGTGCTGTGAGGAATGGACAGTACGGTGCAGGTGTCTTGGTCATGATAAACTGTGATGATT
	CTTTTAAACACTTTCCAAAAACAACTTAGTTCCTTTCATCCTGAATGAGCGTCGTTTACAAACAGCAGTTTGTATGCAAGCACCATTCCGCTTCATTTCA
	TGGTGTTGCTAATATAGTTGAACCAAGGATATGCATTGATACTTTTCATAATTTGTAAATAAAGTTAAAAACAGTTAAAGGAGTGTTTGGTAGAGGTATA
	TGTATATATACCTCACTGCCAGTGAAATTACTTTCCTATGGTATATCTCCTTGCCAGAAATCACTAAATAAAAAGACTTCAAGAATTACAGTGCCTCT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
23a+9dbEST_BB643019.1,dbEST_CN842986.1,dbEST_DT905115.1,dbEST_CJ131365.1,GB_AK044814.1,
1c3a+7dbEST_BB623577.1,dbEST_CJ063977.1,dbEST_CJ168196.1,dbEST_CJ164026.1,
1b3a+4dbEST_BY734526.1,dbEST_CJ184661.1,ENSMUST00000127434,GB_AK144865.1,
3a4+12dbEST_BY734526.1,dbEST_BB643019.1,dbEST_BB623577.1,dbEST_CN842986.1,GB_AK144865.1,GB_AK044814.1,
3b4+4dbEST_CV558785.1,dbEST_CA327487.1,ENSMUST00000127572,REF_XR_107723.1,
1b4+3dbEST_CA873134.1,ENSMUST00000135108,NIA_K0923A12-5N,
45+3dbEST_BY734526.1,ENSMUST00000127434,GB_AK144865.1,
1b5+1ENSMUST00000124263,
56+2dbEST_BY219207.1,ENSMUST00000124263,
28+3dbEST_BU705546.1,ENSMUST00000045466,GB_BC057405.1,
58+3dbEST_BY734526.1,ENSMUST00000127434,GB_AK144865.1,
68+4dbEST_CN673221.1,dbEST_BY219207.1,ENSMUST00000124263,NIA_A0931B07-5,
1c8+3dbEST_BY719513.1,ENSMUST00000137285,GB_AK162026.1,
78+2dbEST_CN535030.1,ENSMUST00000122980,
1b8+6dbEST_BB663850.1,ENSMUST00000112696,ENSMUST00000112695,ENSMUST00000112698,REF_NM_026856.2,GB_AK053146.1,
49a+3dbEST_CA873134.1,ENSMUST00000135108,NIA_K0923A12-5N,
89a+24dbEST_BQ886286.1,dbEST_CN535030.1,dbEST_CD552031.1,dbEST_BU705546.1,REF_NM_026856.2,GB_BC057405.1,GB_AK144865.1,GB_AK053146.1,GB_AK162026.1,
9a10+13dbEST_CN531261.1,dbEST_BF179656.1,dbEST_CR757327.1,dbEST_CA883956.2,REF_NM_026856.2,GB_BC057405.1,GB_BC030844.1,
1011+18dbEST_CA980207.1,dbEST_BI692424.1,dbEST_CN689804.1,dbEST_CN687110.1,REF_NM_026856.2,GB_BC057405.1,GB_AK122471.1,GB_BC030844.1,
1013+3dbEST_BI558559.1,dbEST_BQ570734.1,dbEST_AI616192.1,
1b13+4dbEST_BY320658.1,dbEST_BI079106.1,ENSMUST00000149128,ENSMUST00000125895,
1113+14dbEST_CB520959.1,dbEST_CF903126.1,dbEST_CB588684.1,dbEST_BI663284.1,REF_NM_026856.2,GB_BC057405.1,GB_AK122471.1,GB_BC030844.1,
1213+3dbEST_BB615067.1,ENSMUST00000112694,GB_AK076712.1,
813+1ENSMUST00000112695,
1314+21dbEST_CO434549.1,dbEST_BI558559.1,dbEST_CB520959.1,dbEST_BI079106.1,REF_NM_026856.2,GB_BC057405.1,GB_AK122471.1,GB_BC030844.1,GB_AK076712.1,