NIA Mouse Gene Index (mm92)

Exon structure for U026669

chr5 -

Exon1 121038682 - 121038512
	GAGTGACAGGAGTcggcggatgcgaaggctggcgcagctgccgctgtggcagcggtgaggcggcggtggcggctgctgaggctccgcgctggggatattg
	gcggcggcaactgcggGCTGAGCTACGCTGTGCAGACCCAGTGCACAGTGCGGGATCCCGGGACGGCGCGT
Exon2 121035437 - 121035194
	ACCTTAGAAGATGCCTCTGATGGAACAGGCTCTGGGAAGCTTCCCCGGCCCCGTGGCTTTGAACAGGAGCTCAAGCCGGAGGCAGTTTAAAGCCCTGGCC
	GTTGTATCCTGAGGACCGCAGGTCAGGAGAAGATGGCTGTAAGTTTAGATGACGATGTGCCGCTCATCCTGACCTTGGACGAGGCTGAGAGTGCTCCGCT
	GCCTCCTTCGAACAGCCTGGGCCAAGAGCAGCTGCCCAGCAAAA
Exon3 121032991 - 121032937
	atcccaggatcaccagcccagggatggctcaatgggcggggccctctgttgtgtc
Exon4 121010352 - 121010225
	ATGGGGGCAGCCACAGCATCCACAACTCCCAGGTCCCCAGTCTGGTCTCCGGAGCGGACAGCCCCCCCTCCAGTCCCACCGGACACAACTGGGAGATGAA
	TTATCAAGAGGCGGCAATCTACCTCCAG
Exon5 121007955 - 121007779
	GAAGGTCAGAACAACGACAAGTTCTTCACCCACCCCAAGGATGCCAGAGCGCTGGCGGCCTACCTCTTCGTCCACAACCACTTCTTCTACATGATGGAGC
	TGCTCACGGCCCTGCTCCTGCTGCTGCTGTCGCTGTGCGAGTCCCCCGCTGTCCCCGTGCTCAAGCTGCACACTTAC
Exon6 121006594 - 121006481
	GTCCACGCCACGCTGGAACTCTTTGCCCTCATGGTGGTGGTATTTGAACTCTGCATGAAATTGCGGTGGCTGGGCTTCCACACGTTCGTCCGGCACAAAC
	GTACCATGGTCAAG
Exon7 121006007 - 121005877
	ACGTCCGTCCTCGTGGTGCAGTTCATCGAGGCCATTGTGGTGCTGGTTCGGCAGACGTCCCACGTGCGGGTGACCCGGGCACTACGCTGCATTTTCCTGG
	TGGACTGTCGCTACTGTGGCGGTGTACGGCG
Exon8 121005230 - 121005142
	CAACCTGCGGCAGATCTTCCAGTCTCTCCCACCCTTCATGGACATCCTCCTGTTGCTGCTCTTCTTTATGATCATCTTTGCCATCCTCG
Exon9 121004319 - 121004285
	GTTTCTACTTATTCTCCACAAATCCTTCCGACCCC
Exon10 121003820 - 121003762
	TACTTCAGCACCCTGGAGAACAGCATCGTCAACCTGTTCGTTCTCCTGACCACAGCCAA
Exon11 121003551 - 121003452
	CTTTCCAGATGTCATGATGCCCTCCTACTCCCGGAACCCCTGGTCCTGCGTCTTCTTCATTGTATACCTCTCCATTGAGCTGTACTTCATCATGAACCTG
Exon12 121000051 - 120999935
	CTCCTGGCCGTGGTGTTCGACACCTTCAACGACATTGAAAAGCACAAGTTCAAGTCTTTGCTGCTGCACAAACGGACCGCCATCCAGCATGCCTACGGCC
	TGCTTGCCAGCCAACGG
Exon13 120999624 - 120999500
	AGGCCGGCTGGCATCTCCTACAGGCAGTTCGAAGGCTTAATGCGCTTCTACAAGCCCCGGATGAGTGCAAGGGAACGCTTCCTGACTTTCAAGGCCTTGA
	ACCAGAGCAACACGCCTCTGCTCAG
Exon14 120998328 - 120998280
	CCTGAAGGACTTCTATGATATTTACGAAGTCGCTGCTCTGCAGTGGAAG
Exon15 120998007 - 120997944
	GCAAAGAGAAACAGACAGCATTGGTTTGATGAGCTCCCCCGGACAGCCTTCCTCATCTTCAAAG
Exon16 120997502 - 120997458
	GGATTAACATCCTTGTGAATTCCAAGGCCTTCCAGTATTTCATGT
Exon17 120995730 - 120995535
	CTTTAAGAggggctggagagatggctcagcggttaagagcactgactgctcttcccagaggtcctgagttcaaatcccagcaaccacatggtggctcacg
	accatctgtaatgagatctgatgccctcttctggtgtgcctgaagacagcttcagtgtgctcataaataaaataaataaatctttaaaaGCTTTAA
Exon18 120995323 - 120995267
	ACTTGGTGGTGGCTGTCAACGGTGTCTGGATCCTGGTGGAGACATTCATGTTGAAAG
Exon19 120995137 - 120995084
	GTGGGAATTTCACCTCAAAGCATGTGCCCTGGAGTTACCTCGTGTTTCTTACCA
Exon20 120994494 - 120994422
	TCTATGGAGTTGAACTGTTCATGAAGGTGGCTGGCCTGGGCCCTGTGGAGTACCTGTCCTCTGGATGGAACCT
Exon21 120993461 - 120993354
	GTTCGATTTCTCGGTCACGGCATTCGCCTTCCTGGGACTGCTCGCACTGACGCTCAACATGGAACCCTTCTATTTCATTGTGGTCCTGCGTCCCCTTCAG
	CTGCTGAG
Exon22 120992535 - 120992464
	GTTATTTAAACTGAAGAAACGCTACCGCAACGTGTTGGACACCATGTTTGAGCTGCTGCCGCGGATGGCCAG
Exon23 120991976 - 120991887
	CCTTGGCCTCACGCTGCTCACCTTCTACTATTCCTTCGCCATCGTGGGCATGGAGTTCTTCAACGGGCGGCTGACCCCCAACTGCTGCAA
Exon24 120990698 - 120990583
	CACCAGCACAGTGGCCGACGCCTACCGGTTCATCAACCACACTGTGGGCAATAAGACCAAGGTAGAGGAAGGCTACTACTATCTCAACAACTTTGACAAC
	ATCCTCAACAGCTTCG
Exon25 120989844 - 120989798
	TGACCTTGTTTGAGCTCACCGTTGTCAACAATTGGTACATCATCATG
Exon26 120989287 - 120989219
	GAAGGCGTCACCTCGCAGACGTCCCACTGGAGCCGCCTGTACTTCATGACCTTTTACATAGTGACCATG
Exon27 120989096 - 120989012
	GTGGTGATGACCATTATCGTGGCCTTCATCCTGGAGGCCTTCGTCTTCCGCATGAACTACAGCCGCAAGAGCCAGGACTCGGAAG
Exon28 120987960 - 120987821
	TGGACAGTGGCATCGTCATCGAGAAGGAAATGTCCAAGGAGGAGCTTATGGCCGTCCTGGAGCTTTATCGTGAGGAGCGAGGCACCTCCTCTGACGTGAC
	CCGGCTGCTGGACACCCTCTCTCAGATGGAGAAATACCAG
Exon29 120987650 - 120987570
	CAAAATTCCATGGTGTTTCTGGGACGGCGATCGAGAACCAAAAGTGACCTGAGTCTGAAGATGTACCAGGAGGAGATCCAG
Exon30 120986233 - 120984166
	GAGTGGTACGAGGAGCATGCCCGGGAACAGGAGCAGCAGAAGCTCAGGGGCAGCGTGCCCGGCCCTGCAGCCCAGCAGCCCCCTGGCAGTCGCCAGCGCT
	CCCAGACTGTCACCTAGCTGGGTTTCGTCAAGCCAGCCTCTTCTATGCAATAACACCATAGTATTATGTACTAGGACGTATGGGAACCATGTGTGTATGT
	AGACACACTCATATATATGCACATATTTACACAGAGACAGAAAAGAGACTATAGCCAGGGTCCGTTCCAGCCACCTCGCTCTGTCTTCCTGAGCTCCAGA
	AATAACCAGCTTAGGCTGGAGGCCCAGGCCTGGCGGAGCTCTCGTCCTACCATGGAAAACTCTGGAAGCCCTCTGCTCAAGAAGCCCCTTAAATAGGCTA
	TCTCGTCTCAGCAATGCCGGCTTTCCCCGGGGAGGGATGGGGGGAGCTTGACCGCCTCCCTACTGCGGCCTCCAGCTTCGTCCCTACCTGAACCCCAGCC
	AACACAGGTGTCTGTGTCTGGTATGAGGATCAAAACCACTAGGAAGAAACCCCACACCCTGCAGGATGACATCTATCAATGACAAAAGTGTTAGAAGGTT
	CCCTTGAGGGAGACAGAAGAGCTTACTCTCTCAGGCTCCCAGTCCTTTCTTGTTGCTGGAACCCTACCACAACTcccccacccccacccccgggaacccc
	cacccccacccccGGCAGGATCCCTCCATGCAGGAGAAAGCCAACCAGAGGCCCTGGGAATTTGACTTGCTCAGGGGAGTTCATTTGAACTGGTGCTGAA
	GGCAGCCCCCCTCACCAACCACACTTTCACACTGCCTCCTCCAAGATTCTCATAAGCTAGGTGGGTAGGGGTGGCGAGTCAGGTCAGGTGACTTGTGGGA
	GTTCTTTTGAGGCCACCATAGTATATGGTGGCAGAGCGATGGAGCCCTGCTGTGTTGTCCACAAGGGGCTGAAGGTGGGCAGGGCCCGAAGTTGCCTAGC
	ACCCCCACCCCCCCACCCCTGCGCACTCCCTCCAGGCTAACCTGGCCTTCCAAACCTGCTGTTGCTTGGGAGTTGGAGTGGGCAGGCACAGCCCCCCCCT
	CCTGTTCTCCCAGCCGCAGAACCAGGGGTCAAGCTGGAAAGCGGATGTTTTTACTTTAAATAAAGCACAGTTGCCCCCCCCCCCCCAATACATACACTAT
	CCCCCAGGAAAAACCTCTGGTTTCCACAGAGAGTCAGGAGACTGGCCAAGTCCCTTCCACTTCAAAGAGCTCTTGGCCTCCACTTGGACTCCAGTTCCCA
	ACCCTGAGAAGCAGTTTCATTTCCATAGCCGGTTGCCTTAGCTTCTTTGTGTGTGAGGGGCATTTTGGAAGCAGAAAGAGGGGAGGCCTATAAAGAGGGC
	GGTGGGGGGGGGGAGGCTCTGAGCAACTGCCTGGTTCTAGGCCCCTTCCTCTACCCCAGGTACCCTCAGCCTAGGGGAGCAGGCTCAGGTGGAAGGGACT
	GGTCTTGGGCCCCATGTAGAGGTACTAAAACCCCTGGGTCTAGCACATACCAGCCAGGTGCCTGAGCAAGACAGGGCCCTCAGGCCAAACTGTAGCCCCA
	CAGAGTCACCTTTGAGCACACACCAAGCTGACCCTCAAACTTGCTAGCCAGGCAGGGAACAGACTGTGTCGCCCAGGGCTGTAAGCTGAGACCCCTGGGA
	TCCCTGTCTAAGCTAGATGCCCCTTCCCTCCATTCAGCAGAGTGAGAACTAGTGGCTCCGTGTCACAGCCTAGCAGGGGCAGCTACGGAACCACCACGCT
	GCTTCTCCCGAGTGGGGATAGGGCACTCTGTGGGAACCACCACGCTGCTTCTCCCGAGTGGGGATAGGGCACTCTGTGGGAACAGTGTCCGGCCCCTCCC
	TCTCGCTTCTCCACCCCCTCCACCCCAGCCTTACTCCACACCGTGCAGACAATCATTTTGTATGGGTTAAGAGCCACGTCGTCGGAAGGTTTTATACAGT
	GATTTGTTACCTAGGAACGCACTGTGCCCAGATTTCTGGTGTGCCAATAAAAGAGCCTCTGCTTTATA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+36dbEST_CA324792.1,dbEST_CB524258.1,dbEST_CB523608.1,dbEST_CN460827.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AF217002.1,GB_AK077411.1,GB_AK037856.1,
23+1dbEST_AA510278.1,
24+26dbEST_AI789829.1,dbEST_CA324792.1,dbEST_CB524258.1,dbEST_CB523608.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AF217002.1,GB_AK077411.1,
45+28dbEST_AI789829.1,dbEST_CN461006.1,dbEST_BQ769909.1,dbEST_CJ056220.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,GB_AK077411.1,
56+18dbEST_CA328984.1,dbEST_CA328995.1,dbEST_CD349647.1,dbEST_CN461006.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,GB_AK077411.1,
67+16dbEST_CD348991.1,dbEST_CA328984.1,dbEST_CA328995.1,dbEST_CD349647.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,GB_AK077411.1,
78+14dbEST_CD348991.1,dbEST_CA328984.1,dbEST_CA328995.1,dbEST_CD349647.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,GB_AK077411.1,
89+13dbEST_CD348991.1,dbEST_CA328984.1,dbEST_CA328995.1,dbEST_CD349647.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,GB_AK077411.1,
910+14dbEST_CD348991.1,dbEST_AW321173.1,dbEST_CA328984.1,dbEST_CA328995.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,GB_AK077411.1,
1011+15dbEST_CO433211.1,dbEST_CD742519.1,dbEST_CD348991.1,dbEST_AW321173.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,GB_AK077411.1,
1112+16dbEST_CO433211.1,dbEST_BU613880.1,dbEST_CD742519.1,dbEST_AV173300.2,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,GB_AK077411.1,
1213+15dbEST_CF727280.1,dbEST_CO433211.1,dbEST_BU613880.1,dbEST_CD742519.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,GB_AK077411.1,
1314+12dbEST_CF727280.1,dbEST_CO433211.1,dbEST_BU613880.1,dbEST_CD742519.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,GB_AK077411.1,
1415+12dbEST_CF727280.1,dbEST_CO433211.1,dbEST_BU613880.1,dbEST_CD742519.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,GB_AK077411.1,
1516+13dbEST_BQ571548.1,dbEST_CF727280.1,dbEST_CO433211.1,dbEST_BU613880.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,GB_AK077411.1,
1617+1dbEST_CD742519.1,
1618+10dbEST_BQ571548.1,dbEST_CF727280.1,dbEST_CO433211.1,dbEST_BU613880.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,
1819+10dbEST_BQ571548.1,dbEST_CF727280.1,dbEST_CO433211.1,dbEST_BU613880.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,
1920+8dbEST_BQ571548.1,dbEST_CF727280.1,ENSMUST00000046426,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,
2021+8dbEST_BQ571548.1,dbEST_CF727280.1,ENSMUST00000046426,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,
2122+7dbEST_BQ571548.1,ENSMUST00000046426,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,
2223+8dbEST_BU610273.1,dbEST_BQ571548.1,ENSMUST00000046426,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,
2324+8dbEST_BU610273.1,dbEST_BQ571548.1,ENSMUST00000046426,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,
2425+8dbEST_BU610273.1,dbEST_BQ571548.1,ENSMUST00000046426,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,
2526+7dbEST_BU610273.1,ENSMUST00000046426,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,
2627+8dbEST_BU054568.1,dbEST_BU610273.1,ENSMUST00000046426,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,
2728+8dbEST_BU054568.1,dbEST_BU610273.1,ENSMUST00000046426,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,
2829+14dbEST_BI732554.1,dbEST_CB245511.1,dbEST_BF136133.1,dbEST_BI145003.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,
2930+15dbEST_BI732554.1,dbEST_BF136133.1,dbEST_BI145003.1,dbEST_BU054568.1,REF_NM_145853.2,GB_BC058951.1,GB_AK148129.1,GB_AK137626.1,GB_AF217002.1,