NIA Mouse Gene Index (mm92)

Exon structure for U026960

chr5 -

Exon1 147775373 - 147775288
	GGAAGCCGACGCGGTGCTCCGGCGGAGTCCAGGTACGGACCTGCTAGTTCTTCCTGCTCGCCTACCCCGGCCCAGGTAACGCTGAG
Exon2 147774956 - 147774797
	ggtctcactatttatctctggctgtcctgaaacgcactcggtagaccagtctgacctcaaacctatagaaatcctcctgcctctacctccgaagtgctgg
	gattaaaggcgtgcaccgctcgccgtgtcaggacttttGAAATTCCTTCCGGAATTGAAG
Exon3 147770852 - 147770401
	GATGGCTGTTCTTCTGATGAGGTTGATGCTACAAACTACAAAGCTTGACCATAACTTAATTGGAAGATGTTTGCAAAGACACGCTGTGAAGCCAGATCCA
	GCACAGCTGTCCCTGTCTGCGTCCACCCCAAAGCTGTTGTACCTGACTTCTGCAAAAGGTTTTAGTACTGCTGGAGACCCACAGGGTGAGAGGAAACAGA
	AAAGAAGGGATGCTTTCTCTAACACCGGCCGGAAGATTAGTGAGCGGATTATCCGCGTCCTGGATGAGAAGGGCATGGACCTGGGGATGATGCATCGAGC
	AGATGTGATCAGACTCATGAACAAGCAGGACCTGAGGCTGGTGCAGAGGAACACCAGCTCAGAGCCACCGGAGTACCAGCTTATGACCGGAGAGCAGATC
	CACCAGGAGCGGCTAAAGCTCCGGGAACAGGAAAAGGCCAAACCCAAAACTG
Exon4 147768520 - 147768363
	GACCAACTATGACGAAAGAGCTCGTTTTCTCTTCAAATATTGGACAGCACGATTTAGACACCAAGAGTAAACAGATCCAGCAGTGGATAGAGAAGAAATA
	CCACGTTCAAGTCACGATAAAGAGGAGGAAAGATGCGGAGCAGTCAGAGGAGGAAACG
Exon5 147767391 - 147763149
	GAGGAGATATTTAACCAGATTCTCCAGACTATGCCTGACATAGCAACCTTCTCAAGCAGACCAAAAGCCATCAGAGGAGGGACTGCTTCCATGTGTGTTT
	TTCGTCACTTGAGCAAGAAAGAAGAAAAGGCGTACAGAGAATCCCAGGAGAGCCAGAGAAGAGACACTTTGAGCAAAGACGACGACGGAAACAGCAAAGA
	GTCGGATGTTGTGTGTCAGTGACTTTAATAGGAAAAGTGCAGGCCAGGAGCCTCTGCTGGCCGCCCTGAAGTCTTCCCGCCTAGCAGACAGTGAGTAAGG
	CGGCTGGCGGGGGCAGCTGGGCCTCTGGGCTGCTGCTGGACTCTGCGCTGGCGTTAGGCAAGGAGTAGTCGGGCTCTTGTTTCCTCTTAGGAGGGAAGTA
	CCCACTGAGGCGAGAGGCCAAGCTGCGTCTCTCCCGAGGGGCTCTTACCTTCAGGAGTGAGGAAGACAGACAACTGAGTTGCCCATTACACAACGGGGAT
	CCACTCCAACAGATGAGCCCCTGATGGGAGTCACACCCTCAGCAGGCACAGACACGCAGGATGGGGTATGCGGATGGACAGACGCCAAGCAGGCCTCACA
	GCCGAGTGCTGGCCCCAGCAGCTGCCACTTACTTTGAGCTTCATCCTCTTCTTGTCGGGATCGTGCACGACACTGTGCCTCATGAGACTCTGCTGCAGTG
	CAAGGGAAAGAAGGACGCTTGACCTgggcctgcagacgtggctcagtgcttacagcattcgctgctcgaggaggacacgggtttggttcccagcacccgt
	aCTCCAGTTCCAGTAAAAACTCTTGGTGTCTGCTAACCTTAAGATGCAGTGGTCCAGTGTGCAATAATAAACTACCAGCTGCCTTTCTGTTGTGTAGTGA
	ATCTGACCTTCACCTGACTCCCTAACCAGAGCCAACTCCTTGGCAGAGCGAGCGACTGTCAGCCTGCTGACACGCATGGGATTTACTTCTTCCCGGTCCT
	CCTGAGAAGGGAAAGCCGGCTATGCTTGAACATCCAGGCTCATGCTGGGGTAACTGAATCTACCTCAGCTGCGTCCCTAAGTGCCAGGGGGAAATCTGAC
	CTCTGCCCTGCTGGCTATGCTGACAGTGCTGACCACGGGACCTTTGCTGTGGGCTGGTCTGGGTTATGTTCAGTGACTTTGTAATCCACAGTAAGAGCTC
	TTTAGAAACCAGCTAGGCTTAGGCAAACTGTTCAGTTCCCTACTAGGAACCATGTTCCCACGCGATCCATGAATCATGCCAAGATTCCAGAGTCTAGAGG
	CTGTGCATTTGTGCTACCCACCTCCTCTCCCAGACCCTAGGCGACGGTCAGAAGCTCCTAATCACCTCAGAACATCCTCTAAGTAGGAATACAGGCCCCG
	GGCTCTCCCACTCAGCATGGCTAGAATCCCCCAGGagtggttctcaacctgctactcatgactcctctggggtcatataccagatcgcctgaatatcatt
	atttacaatccataccagtagcaaaattatagttatgaagtagcaactaaataatattatggttgggggtccccacaacatgaggaactgttattgggtc
	ccagtattaggaaggttgagaaccactgCTCTAGAGGTCCTAAATAGGCCTGTTTAGCCTCCCAACCCCAGGGCTCCTGCATTTCCAAGTTCTGCAGGCT
	GGACATGAACACACCAGCCTGGAGCGGGAGACACTCACTTTCATTGCGAATGTCTTGCCACAGCCAGCGTGCTCACACACAAATGGGCGCTTTTCCTCGT
	GGAAGGAGAGAATGTGGCTCTGCAGGTTGAACACGGTTGTGTAGGTTCTTCCGCAGCCTTGCCGCGGACAGCGGTACACATCCCTTTCCGGGGCGTGAGT
	CTTCATGTGCTGCTTAAGGTAATCTCTGCGCTTGAACATCCTCTGACATACATTGCAGGTTATGTCCTCTGGGAGGAGAAACACACACGTGTAACCAGCG
	TCCCATGAGTAACCCGTCTGGTCCTATGACTACACACAATCTGGGGACTTCACATGGGAAATGTCAGCTTGTCTCACTGCTATGCTGGTTTCAAATTCCT
	CAAGTTCACTCATGGCTCCCAACATCCTGAGTCCTCGCCTGTCAAGGAGCAGGCGTCCTCGGTGTGATAACTGAGCACGAGGAAGTATGCCCTCATAGCA
	TCTACCTTTACCCTCTGACACAGTAGCATCTGCTAAGTCCTGCAGGGCCTCACGAACACCCGGGCACAGCCGCACCAGCTCTGAGGCCTGCAGGGCTCCC
	TCGACTGTCACAGCCCAGGAAGCCAGCACTACCCTGAACTCGATGCAGAGCCCCCTTCCTTTACAGCGCAAGTGGGTATCTCACTCTCTCAGAGTACACC
	ATGCACTCCCCAGAGCTCAGAGCACACACACCATGGGCTCCCCGGGGTTCAGAGCACACCGGGCTCTCCCCAGGGCCGATGCGCTTCCACAGCTCCTGCC
	TACCTTACCTTTATGGGCTTCTCTCATGTGTTTCAGGAGCTCTGTCCACGTTTTTCCCATGAAAGAACATCCCTTTTGACACAGGTAGCCTGTTCAAAAC
	AAAAACAAAACAAGTTACCCACAGCCTGTTGAATGCCCAGGGCAATCCCTAATGACAGCCAAGAAAGCCCGTGCCAAGTGCACTCCCCTCTCTGAAGTGT
	GCTGCTCTGCTGGGTGCAATGCAGCGGGCTCCAGTGGCCCCTGCTCTGAAAGCTCCCATCAGCCAGACTTTTGCACACTTGAGTGGCACATAACCAGGTA
	GCGTAGGAACAGTATAGCACCAGTGGACGTGGCAAAGAGGATAGCGGCAAAACACACAGCACAGTGTCTCTTGGCATAAGAGGCAAACACTCAAATAACA
	CAACAGGCGCTTGCTTGTCACAGAACTTTGTCTACTCAGCGTGACTACAGAATAGACCCAGCCTACCCTGCCGGTGGCATGTTCCTCGCGGCCGGCACAG
	TCCCCATCTACGTACCCTCGTGAACTTTCCCATGCCGTTTCAGCCTGCTGGGCGAGGCAAAGTGCTTCCCGCATCCCTCGTGGGTACACCTAGGACAATA
	GCAGGCAAAGCATCAGCCAGGCCCTTTCCATGGACAATTCTAAGATTCCCTCTTCTCCCACACCAAAGCCCATGTCTTCCCACACCACACCTGTCATCCA
	AAACAAAGAGTAAGTACAGTCCCGAATATGGACATAGTGGCTTGGCCAGCTTGGGAGCAAAACAAGCCATCCTGAGAAAAAGTCACATCTTTTGTTTGTG
	TTATCAAACTAAAAGTTCTCTGAATTCTGGAAATGTGGCTACAGAAGCGACATCAAGAGGCTGTCTGACTCGGTTTGCACTGGACCAGACACAGAGCTGT
	TGTCTGGGGTCTGCCCAATATGCTGCATACGGTCAGATGAGAACACAGCACAGAGGCTGGGGACCAGCACCAGAAACACACGAGAATGTACAGCAGTCGG
	TGCAGAGCTCCAGGCACTGGCAGCACAAACAGGCCACAGGGCTGCTGGTAAGACCTCGGTCACTGTAGCTGCACCAGTGCAAAGAGCAGCCTATGGGAGC
	CAGGGGCAAGGCCCCATCACCCGGACTGTGCAGGGAGACACTGCCCTAGGAGGGAGGCAGGCAGGTAACCTGGCACCCCTGCCCACCTCCTCTTTGTCCC
	TCTTGAGTACTCAGGAATCCCTCAAAACAAGCAGGGCCTCATTACTCCTGTTCTATAGTAAGAAAAAAAAAAGCCCTCATGACACAGAGCCTTCCTCGGG
	ATCCTGATCTTAGCGTTCTACTCTGAATCCCAGAGCGCTGGCAAAGCACCAACCTGAAGAGCGGCTCGCTGGTGTGCTGGCACTGATGGGTTCTCAGCTG
	CTGGTGCTTCTTAAAGGCCTTCTTGCAACCCTCATAACTGCACTGTTTAAAAAAAATAAATGCACGGTTTAGTACAGGCAGGGGATCATCAGTTGCTGAA
	GTCCTTTAAAAggcaggagagattgctcaatggttagggacacttgcttctctggtcccaggtttggactgcagcacccacgtggtgcctcacaaccatc
	tgactccagttccacaggacctcacaccctcttctgacctccacaggcaccgagcacgcatatggtatatagatacatatgcaggcaaaacgcttgcaca
	taaaaCCTTTTTTAACTAAACAATAAAGTCTCTCTGGATCTGA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+4dbEST_CN721023.1,ENSMUST00000110564,GB_BC115685.1,NIA_E0814E04-5,
13+10dbEST_CX216647.1,dbEST_CX239131.1,dbEST_CJ094066.1,dbEST_CB952533.1,REF_NM_029581.3,GB_BC052439.1,GB_AK147090.1,
23+12dbEST_BY711851.1,dbEST_AI605628.1,dbEST_CN721023.1,dbEST_BY340593.1,GB_AK012733.1,GB_BC115685.1,
34+22dbEST_CF732515.1,dbEST_CD352928.1,dbEST_BF159823.1,dbEST_CX244340.1,REF_NM_029581.3,GB_BC052439.1,GB_AK147090.1,GB_AK012733.1,GB_BC115684.1,GB_BC115685.1,
45+20dbEST_CO429882.1,dbEST_CF732515.1,dbEST_CD352928.1,dbEST_BF159823.1,REF_NM_029581.3,GB_BC052439.1,GB_AK147090.1,GB_AK012733.1,GB_BC115684.1,GB_BC115685.1,