NIA Mouse Gene Index (mm92)

Exon structure for U026978

chr5 -

Exon1 149864622 - 149864476
	GAGAGTAATGTTACAGAGCGGAGAGAGTGAGGAGGCTGCGTCTGGCTCCCGCTCTCACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGG
	CAAGCGCGAGCCGGACGGGCACTGGGCGACTCTGTGCCTCGCGGAGG
Exon2 149863953 - 149863914
	gggtgggccgggggcggccgtgcggggcggctcgggccgg
Exon3 149863330 - 149862855
	TCTCCTTGCTCCGGGGCCCGACAAAATGGGGGCGGCGGCGGCGCGAGCCTGCGTGCGGCCTTCCGGGCGCACGTGGCGGCCTCGGGCCCGCCCGGAGCCG
	CAGCCCCCCTCAACCTCGGGCCAAGTTGGGAGGGCGGAGAATCAATCCTGCCCGCGCGCGCGCCAGGGCACCCCAACTTTTCACGGGCCCGGTTTGGGAG
	ACaaacaaacaaaaaaaaagacaaaaaaaaaaaaaaagaaGAGAGCGTGCCCGACACCCCCGTGGTGGCGGAGGAGGCGGCGGCAGGAGTGGCTTTTGTC
	CCTCATCCTTGTTTACTCGGAGAAACTTCAGACCGGACGTGTTTAGTCAGAGCAGAAACGCATCTCGGGGCCAAAGCGATAGGAAACTGCGGCCTCTccg
	ggccccggcccagcgccgcctccgcccgcccgcccgAGCAAAGTTTGATGCGAACACGGCGTGCTCTAAGAGCTGG
Exon4a 149862327 - 149862164
	AAAATCAACTAAACATGGGCAAAGGAGATCCTAAAAAGCCGAGAGGCAAAATGTCCTCATATGCATTCTTTGTGCAAACTTGCCGGGAGGAGCACAAGAA
	GAAGCACCCGGATGCTTCTGTCAACTTCTCAGAGTTCTCCAAGAAGTGCTCAGAGAGGTGGAAG
Retained Intron 149862163 - 149862017
	GTAAGAGGGCTTTAGAGATGCTGAGTGCCTCTGAGTTGTAAATTAGGATGAACGGGCTGGGTGTTCTCCTTACTATATGACTATTAAAGTGCTTTAGGCT
	GGCATATTGAACATCTCTATGTCAAGTTTACAAATAATTCTTTCTAG
Exon5 149862016 - 149861871
	ACCATGTCTGCTAAAGAAAAGGGGAAATTTGAAGATATGGCAAAGGCTGACAAGGCTCGTTATGAAAGAGAAATGAAAACCTACATCCCCCCCAAAGGGG
	AGACCAAAAAGAAGTTCAAGGACCCCAATGCACCCAAGAGGCCTCC
Exon6 149861477 - 149861303
	TTCGGCCTTCTTCTTGTTCTGTTCTGAGTACCGCCCCAAAATCAAAGGCGAGCATCCTGGCTTATCCATTGGTGATGTTGCAAAGAAACTAGGAGAGATG
	TGGAACAACACTGCAGCAGATGACAAGCAGCCCTATGAGAAGAAAGCTGCCAAGCTGAAGGAGAAGTATGAGAAG
Exon7 149860489 - 149858278
	GATATTGCTGCCTACAGAGCTAAAGGAAAACCTGATGCAGCGAAAAAGGGGGTGGTCAAGGCTGAAAAGAGCaagaaaaagaaggaagaggaagatgatg
	aggaggatgaagaggatgaggaagaggaggaagaagaggaagacgaagatgaagaagaagaTGATGATGATGAATAAGTTGGTTCTAGCGCAGTTTTTTT
	TTCTTGTCTATAAAGCATTTAACCCCCCTGTACACAACTCACTCCTTTTAAAGAAAAAAATTGAAATGTAAGGCTGTGTAAGATTTGTTTTTAAACTGTA
	CAGTGTCTTTTTTTGTATAGTTAACACACTACCGAATGTGTCTTTAGATAGCCCTGTCCTGGTGGTATTTTCAATAGCCACTAACCTTGCCTGGTACAGT
	CTGGGGGTTGTAAATTGGCATGGAAATTTAAAGCAGGTTCTTGTTGGTGCACAGCACAAATTAGTTATATATGGGGACAGTAGTTTGGttttttgttttt
	ttttttttttcttttggttttctttttgggttttatttttttCATCTTCAGTTGTCTCTGATGCAGCTTATACGAAGATAATTGTTGTTCTGTTAACTGA
	ATACCACTCTGTAATTGCAAAAAAAAAATTGCGGCTGTTTTGTTGACATTCTGAATGCTTCTAAGTAAATACAATTTTTTTTATTAGTATTGTTGTCCTT
	TTCATAGGTCTGAAAGTTTTCTTCTCAAGGGGAAGCTAGTCTTTTGCTTTGCCCATTTTGGGTCACATGGATTATTAGTGTGTTATCTTTCATCTAGTTA
	GCTGGAAGAGAGCTTTTGTCCACATGCCCTGCCATTGTGGTAGGGTAACATTTTCATCCATAGTTGAAGAATCTCCTAAATCGTGATAGTTGGATAAGAG
	ATATTATATAACCTACTTGGCAAAGCAAGGAGTGATCAATACTGTCACACCGTGGGACTATTAGGATCAAGCAATCTGAACGTCTGTCCTTGAAGGACTG
	ATAGAAAAGTACCTTCTAATCCTTACACGAGGACTCTCCTTTAACCGCCATTACTGTGTAATGACAGTTATATTTTGCAGTTTCCCCTACTAAAGAAGAC
	CTGAGAATGTATCCCCAAAAGTGTGAGCTTAAAATACAAGACTGCTGTACTATTTGTTGACCTTAGTCCCAGCGAAGGCTATCACAAGAACGCTGGCTGT
	AAAGCCTTTGCCCTTCTATCTAGATATGGATTGCTCAGGAAACTTGACTGTTTAAAGGTATTTTTAATTACTTGAGCCAGCTTTTAAAATTATGCCACAT
	TTAAAATGAAGGGTATATTTTCCTATACTGTGGTTTGTCCCTTTATGAATCAGATACAAGAGGATAAACTTTGCATATTAGTACCATTTGTCCAATACAT
	TTGCTTTTTCTTTATAAAACCCAAACTCATTCATTAATCAGGTTTAATCTGCTTAGTTTAGGGAACAATTTGGCAATTTTGTGGATTTTTTTTTGAGATT
	ATCGTTCTCTTAAAGTGCCAGTGTTTTAAATAGCGTTCTTGTAATTTCACGCGCTTTTGTGATGGAGTGCTGTTATATAATTTTGACTTGGGTTCTTTAC
	ATTTGCGTTGTTAATGTAATTTGAGGAGGAATACTGAACATGAGTCCTGGATGATACTAATAAACTAATAATTACAGAGGTTTTAAATATTAGTTAAATG
	ACTTTCACTTAAGAATTTAAGCTTTTGGTCACACTTTATAATAGTGCCTTATAGTATAAACAACTGAAAGGCTCTTTCCCATTAACAACCCTTGATGCTg
	gggccagtgagatagtgggtaaaaaggcagttggctgccaaccctgacaaccGATGGCAAAAGGAGGGAACCAGCTTCCAAAATGCTTTGACCAAATGCT
	CCCTCCATTCATGAACACAGTTTTAAAATGTTAAATAGGCTAGAGGGCAGTAAAAACAGGTTTTTTTATCGAGCATCCCTAATCTATACATATGAGGAGC
	CATAATCTGAATGTTAAGTGAAAAGCGAGGTTGGTCTTAAAGATTGCACGTGTGTTCTTAAGCCTGTAGAGGACCTCCGCAGGCCGTAATGGTCTCGATT
	ACCAACTTAAGAACAAGTGACTGGCTTGGAAACTTGTACTGTTGCTTTAGAACTACCATTGTGGACATCTGTTGTTAGTAAGTGATCCATTTAAAAGTGA
	ACTCTGCCTCAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
34a+6dbEST_BI158099.1,dbEST_BB631227.1,dbEST_CK617766.1,dbEST_CJ187465.1,GB_AK037928.1,
14a+689dbEST_BU510257.1,dbEST_BM461329.1,dbEST_BU515190.1,dbEST_BQ947828.1,REF_NM_010439.3,GB_AK144428.1,GB_BC008565.1,GB_BC111468.1,GB_Z11997.1,GB_AK146420.1,GB_AK084841.1,GB_AK157846.1,GB_AK087949.1,GB_BC100312.1,GB_AK150924.1,GB_BC083067.1,GB_BC085090.1,GB_BC064790.1,GB_BC006586.1,GB_BC094030.1,GB_U00431.1,GB_L38477.1,GB_AK051800.1,GB_AK166007.1,GB_BC091741.1,GB_AK082902.1,GB_AK050659.1,
24a+3dbEST_BY281195.1,dbEST_BY277348.1,ENSMUST00000138553,
4a5+763dbEST_BU509954.1,dbEST_CA977293.1,dbEST_BU510863.1,dbEST_BU510257.1,REF_NM_010439.3,GB_AK144428.1,GB_BC008565.1,GB_BC111468.1,GB_Z11997.1,GB_AK146420.1,GB_AK084841.1,GB_AK157846.1,GB_AK087949.1,GB_BC100312.1,GB_AK150924.1,GB_BC110667.1,GB_BC083067.1,GB_BC085090.1,GB_BC064790.1,GB_BC006586.1,GB_BC094030.1,GB_U00431.1,GB_L38477.1,GB_AK051800.1,GB_AK166007.1,GB_AK134228.1,GB_BC091741.1,GB_AK037928.1,GB_AK082902.1,GB_AK050659.1,
56+637dbEST_BU509954.1,dbEST_CA977293.1,dbEST_BU515761.1,dbEST_BU510863.1,REF_NM_010439.3,GB_AK144428.1,GB_BC008565.1,GB_BC111468.1,GB_Z11997.1,GB_AK146420.1,GB_AK084841.1,GB_AK157846.1,GB_AK087949.1,GB_BC100312.1,GB_AK150924.1,GB_BC110667.1,GB_BC083067.1,GB_BC085090.1,GB_BC006586.1,GB_BC094030.1,GB_U00431.1,GB_L38477.1,GB_AK051800.1,GB_AK166007.1,GB_AK134228.1,GB_BC091741.1,GB_AK037928.1,GB_AK082902.1,GB_AK050659.1,
67+412dbEST_AW555741.1,dbEST_BY761655.1,dbEST_BU509954.1,dbEST_BY429783.1,REF_NM_010439.3,GB_AK144428.1,GB_BC008565.1,GB_BC111468.1,GB_Z11997.1,GB_AK146420.1,GB_AK084841.1,GB_AK157846.1,GB_AK087949.1,GB_BC100312.1,GB_AK150924.1,GB_BC110667.1,GB_BC083067.1,GB_BC085090.1,GB_BC064790.1,GB_BC006586.1,GB_BC094030.1,GB_U00431.1,GB_L38477.1,GB_AK051800.1,GB_AK166007.1,GB_AK134228.1,GB_BC091741.1,GB_AK037928.1,GB_AK082902.1,GB_AK050659.1,
11-1dbEST_AV255394.1,