NIA Mouse Gene Index (mm92)

Exon structure for U027865

chr6 -

Exon1 125187045 - 125186775
	CAGCCACAACTGCCTTCAAAGGTCGGTTTACCACCCAAGTGGAGTCGCAGTGGCTGCTGCCCAGAGCACATAGGAGCCACCAGTGACTCGGTACAAGCAG
	TTGGGGCTCAGAAAAGATCTCCCTGGGCAGGAGCTATGGCATGGCCACCTCCCTACTGGCTCTGCATGCTGGGGACCTTGGTAGGACTCTCAGCTACCCT
	AGCCCCAAACAGCTGTCCAGACAAACACTACTGGACTGGGGGAGGACTCTGCTGCCGGATGTGTGAGCCAG
Exon2 125186622 - 125186491
	GTACATTCTTTGTGAAGGACTGTGAACAAGACAGAACAGCTGCTCAGTGTGATCCCTGTATACCAGGCACCTCCTTCTCTCCAGACTACCACACCCGGCC
	CCACTGCGAGAGCTGCAGGCATTGTAACTCTG
Exon3a 125184712 - 125184533
	GTTTTCTTATCCGCAACTGCACAGTCACTGCCAATGCTGAGTGCAGCTGTTCCAAGAACTGGCAGTGCAGGGACCAGGAATGTACAGAGTGTGACCCTCC
	TCTAAACCCTGCACTGACCAGACAGCCATCTGAGACCCCGAGCCCACAGCCACCACCCACCCACTTACCTCATGGCACAG
Exon3b 125184532 - 125184335
	GTATGCAGCAGGCTGCTCCTTACCCAGTCGGGACAAGGCAGAAGGCTGCCTACCCAGCACTGCCCAGTCTGTGTTTACCCCTAGCTAGGTTCTGGGCCAG
	CATGTCTTCCTCCTGTCTGACTCCTGCAAAATCACAGGAAAGCCTGGGACATCCTGGGAGGTTTCCTGCTTGTGACTCGCTCTGTCTGTTTCTTCCAG
Exon3c 125184334 - 125184272
	AGAAGCCATCCTGGCCCCTACACAGGCAGCTTCCCAACTCGACTGTCTATAGCCAGCGGTCAT
Exon4 125183779 - 125183660
	CCCATAGACCCCTGTGCAGCTCGGACTGCATCCGGATCTTTGTGACCTTCTCCAGCATGTTTCTTATCTTCGTCCTGGGTGCAATCTTGTTCTTCCATCA
	AAGAAGAAACCACGGGCCAA
Exon5a 125183449 - 125182906
	ATGAAGACCGGCAGGCAGTGCCTGAAGAGCCTTGTCCTTACAGCTGCCCCAGGGAAGAGGAGGGCAGTGCTATCCCTATCCAGGAGGACTACCGGAAACC
	CGAGCCTGCTTTCTACCCTTGACCGGGTGCTGGTGGGGCCCTTTCTGACGAGGGGCCATCCACAGAGACCTCAATGGTGGCCTGCTCCCCTGTCATGGTC
	ATCAGAACCCTTTCCTGTGAATACTCAACAAACTGCCCTTCTGAGACCAACAGGGACAAGAGCAGGATCCCAGTGTGTGGCCCAGCAAGCTGGGGAGACT
	CAGGCTCTAGCTATAAAGCACACTTACTCTAAGTGAAACCGTCCAGCTGACAAAACTACATGCCAGGGGTGGAAATGGCTCACCAAgggctccagagggg
	gcttggcagtgaggagcacgaagtgttcctccagaggaccagagtttgattcccagcactgtcaaatggatcgaaaccagctgtaactctactttcagag
	ggtctgacacctttgacctcctctggcatctacaaacacaggac
Exon5b 125182905 - 125182640
	ggacacacacacacacacacacacacacacacacacacacacgattaaaaataataattttttttaaaaaaaTGGAATGAGCCACCGGCAGGTGCCCTGG
	TACCAGAAGGACTGACTGCCGTGAGAGACACTATCTACAGACACACAGACTTCCTGGCCTTGGTTCTGTCTTCTCTGTAAGTTGTGACAGTGCTGTGGGA
	AAGCTGAGGCTGAGACTTTCTCTCAGTTGAGCTAAAACTATAAATAAATTCATTTGTCTACTTCTA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+35dbEST_BY746045.1,dbEST_DT924276.1,dbEST_BU694800.1,dbEST_BU698281.1,REF_NM_001033126.2,GB_AK153895.1,GB_L24495.1,GB_AK154005.1,GB_BC139125.1,GB_BC139126.1,GB_AK137770.1,
23a+17dbEST_BY746045.1,dbEST_BE631582.1,dbEST_BU698281.1,dbEST_BY746785.1,REF_NM_001033126.2,GB_AK153895.1,GB_L24495.1,GB_AK154005.1,GB_BC139125.1,GB_BC139126.1,
23c+7dbEST_DT931920.1,dbEST_DT911315.1,dbEST_DT924276.1,dbEST_BU694800.1,
3a3c+19dbEST_DT915862.1,dbEST_DT931986.1,dbEST_DT919412.1,dbEST_DT912593.1,REF_NM_001033126.2,GB_AK153895.1,GB_L24495.1,GB_AK154005.1,GB_BC139125.1,GB_BC139126.1,
13c+8dbEST_DT913870.1,dbEST_AI326735.1,dbEST_AA153731.1,dbEST_DT902918.1,REF_NM_001042564.1,GB_BC171931.1,
3c4+34dbEST_BY761889.1,dbEST_DT915862.1,dbEST_DT931986.1,dbEST_DT915473.1,REF_NM_001033126.2,REF_NM_001042564.1,GB_AK153895.1,GB_L24495.1,GB_AK154005.1,GB_BC139125.1,GB_BC139126.1,GB_BC171931.1,
45a+27dbEST_BY761889.1,dbEST_DT915862.1,dbEST_DT931986.1,dbEST_DT915473.1,REF_NM_001033126.2,REF_NM_001042564.1,GB_AK153895.1,GB_L24495.1,GB_AK154005.1,GB_BC139125.1,GB_BC139126.1,GB_BC171931.1,
5a1-8dbEST_BG865096.1,dbEST_BY761889.1,dbEST_BY762783.1,dbEST_AA940199.1,GB_AK153895.1,GB_L24495.1,GB_AK154005.1,