NIA Mouse Gene Index (mm92)

Exon structure for U027882

chr6 -

Exon1 127059570 - 127059454
	GTAGTGCAGGCAAAGTGGTCCCAGAGTCAGGCGCAGCGAGGTGCTGCTGCAGAGCCGGGTCGTGGCTCACGCGTCTTGTGCCAAAATGCCGCGCTTCGCC
	TTGACCGTTATCCGCCA
Exon2 127051904 - 127051867
	TGGTGAAACAAGACTTAATAAGGAGAAAATCATTCAAG
Exon3 127042760 - 127042639
	GACAAGGCGTAGATGCGCCCCTTTCGGAGACTGGGTTTCGGCAAGCAGCGGCCGCCGGGCAGTTTCTGAGCAATGTGCAGTTTACCCACGCCTTCTCCAG
	CGATCTCACGAGGACTAAGCAG
Exon4 127041279 - 127041195
	ACCATACATGGCATTTTGGAGAAAAGCAGATTTTGTAAAGACATGGCGGTGAAGTACGACTCCAGGCTCCGAGAAAGGGTAACTT
Exon5 127039321 - 127039211
	ATGTACGGAGTCGCGGAAGGCAAGCCGCTAAGCGAGCTTCGGGCCATGGCCAAAGCCGCTGGGGAAGAGTGCCCCATGTTCACCCCGCCTGGAGGAGAGA
	CAGTTGAGCAG
Exon6 127038320 - 127035134
	GTAAAGATGCGCGGAAAGGATTTCTTTGATTTCATTTGTCAGCTAATCCTGGGCAAGGCAGGGCAGAGAGAAAGCGTCCTGCCTGGAGCGCCAGGCAGCG
	GTTTGGAAAGCTCTTTGGCAGAGGTTTTCCCTGTTGGAAAACATGGCAGCTTGGGGGCGAATCCCAAAGGTGGCACCCTGGGCTTAGCAGCCAGCATCTT
	AGTTGTGAGCCATGGCGCTTACATGAGAAGCCTCTTTGGTTATTTTCTGAGTGACCTCAGATGCTCGTTGCCAGGAGCGAGAGACAAATTGGAACTTTCC
	TCCATCACTCCCAACACTGGGATCAGTGTCTTCATCATAGACTGTGAGGAAGCACGCCAGCCATCGATTCAGTGCGTTTGTATGAACCTCCAGGAGCACC
	TGAACGGAGTGACTGAGAAGCAGCACTGAGTGTGGAGCCCGTGCAGTGGAGCCTCTGAAGGGAGGGACTTGGCCTCTGCTGCTGCCATTTTAGAAGCAGC
	GGAGAATTCATGTGTTGAAGCCCCACTGGGGTTGTGGCTGTGTCAGACGTTAGTGGGGAATCCACTCACAGCCAGCCTGGCTTTTCCTGTCATTTTCTAC
	ACTGATTTTTGTCACTCTGTCCCATTATGTCTCTGATCTGTTAACTTATGAGGACATTGAGGCTTGCACATCCGGGGATGAGCAGCCTTCTTTCCACACA
	CTTCCTTTTCCTTGGCCCTTGTGATGTCTAGGTGGTGTTGGCTTTTGAAGATAATTGTATGATTTCACACTCGCTCACCAAGTGCTTGCAAGAAAGAATG
	GTTTCAGTAATACGCTGCGTATTTGCAGTGATCCAAAGTGTTCAGAGTGAAGCTTCAGATCAGTGTTCAAGGTAAAGTGACCGAACACTCTAGTGTCCTG
	GAGAAACTAGCTCTTGGGATttattattattattattattattattattattattattattattGCCTCAGAATACAGCAGAgggactgaaggggtgggt
	gggcagttaagagtacttcctgttactcagaactccagttcagatcccgttacccatgttggggagctcacagctgcctggaactccagcattggagagc
	cagtgccccctctgtgcctctgcagacacttggcacacatacacacaaataaaaGTGATGAAAGCAGCCTCGGGGGAAGAAAGGAATGCACCACTTGATC
	AAAACACACTAAGAATCCCCTGAGCAGAAGGAAAAAGGAGCTCTCCAGGCAAACAGGGTGGGTGAGGGGTTGCTCAAATTGTCCTCTGCTTTGTATCTGG
	CTTGCCAGTTGATCTAAAGAAGAGGTGCTGAAAACTGCTATCTAGAAGGCACAGATGAAGAACCTTCCCTCTAGGTGGCCCTGTAGGAAAGGGATTTTGA
	TTGCTGCTCGGGAGTCCTTAATTGGGAAACCGGATTGAACTGCTGAAATGCCAGCTCACACCACAGCCTCAGGGAAAGGAATTACATGGGGAAACTGTAA
	TCATAACAGCGGGCCCAGATAGGCATCAAACAAACTTAAACCTAGAAAAAGGAAGGAATATGTCGAGGCTCACAGCTGCTAGCTTGCCACAGCTGTAAAG
	CACTGCTAGGTCCTTCCCCTGTCTAGACACTGCGGAGCTGGTGTCAACACTGGGTACTGGTGGCCCCAGACTAGGGATTTCCTTGAGATTCCATATGCAT
	ATGTACCTTGCACAAAAACATCACTAGTGTGCACCCAAAGTGTGGCCATCTTCCGAGAAACCCAAAGACGTGATTAAGGGGGCCGCAGAAAAGTTGCCCT
	ATGGGTGACAGCAAACTTCAGCCCAAAAGTGGCGCCAGCATCGGAGCCAGTGGTGGATGCGTGAATTTGAGAGGGAAGCCCGAGGGGTCTGGAGGTGGTC
	TTCAGTGGGCCCTGGGTTCCATCCTTGGTATTAGGGGGGAAAAACAAGAAGGCTGTGGGTTTGGTTCTCTTCCTACTTCTGTGGAGGCCCCCCACCCCGA
	CCCGGCAAGCCTTCAGGTGTCAACAGTGTGGTCCAGGGAACAGTTGTGACAAAGTTTGGTGGGCTGGCTTCGTCTCCAGTTGGACTCTTGTCTGGCCTGA
	GTCTCTGCTGCTCCCCTGAGAGTGATTTCTCTTCCTCCTTATCAGGCTGTATTTTCCCATCCCTAAGAGTAGATGATAAAATGTTACATTTTGAACACAT
	TAAAAGAAATTTAAAAATACACAATGGTTAGGCTGCCTCAAAGCAGTGTCCAAGTGTTATTTTGATCTAAAGTCAGGTAAGAAGAAATGGCAGCTTTGCC
	TAACAACAGTATAACCTCAGACCTCATCCTTCTCCTCTTCCCCCCCCCACTCCCCAAGCTCCCAGGGATGCCTTGATACCCGTCTTGGTACTTGCGGAGC
	TGCATCCTACCACCCCCCACCCCCACCCCCTCCGTGGCCTCCAGTCAGACCCGCTCACGTTCCACTAGGTGGATTTGTTACaaaagattatttttttttt
	agcaacttcaggtttatggaaaagtcaaacaaggagaagttcccctacacaccctcccccccccccatttattctgttggcaaaatctcgcCACAGCGTT
	GAAGTCTGTATCTGAACGAAGTGTGCCGTTTGTCAGTTTTGTGTTACCACGTTAATGGAGTGAATGTCGCCTTCCTGTGAGCTCAGCGTTTCCTCTGGCT
	GTCATCTCCATTGTATAGAAAGTCCAGCATCCACACCATTCTTAGTGTGCCCCGCACTACCTTTTTCTGCCGGTGATGGATACGTGAATTTGAGAGGAAA
	GTTATAAAAAACCTGAAGGGTCTGGAGGTGTTGCTCATTGggccctgggttccatcctcagtattgggggaaagaaacacaaaaggagaacaaaacaaaa
	aCCTACTTTTAAAGAAGAGAAATCCAGTGTTAGTGAGGAAATGCAGGGTGAGCTAGGGGTCTAGTGTAGACCAGGTGCAGAGCATCATGGGAAGTCCTCT
	GGTTCTTTACCAGGAGCATCTGAGCAGCAGTGTTGTTCCAATGCCTTTCACGTGTACAGAAATACCCAGCTATCTGTAGTCTTTGTTTTACCCATATTGT
	TTGAGGCACTATTTATTTGGGAATGTATGGATCTACTTAATTGTAACCAGTATTCTACTGAATAAAGCATCTTTTGTTTATAAAGGA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+43dbEST_DV041294.1,dbEST_BY733060.1,dbEST_BY726473.1,dbEST_BY725557.1,REF_NM_177003.5,GB_AK145896.1,GB_AK165614.1,GB_AK036082.1,GB_AK163290.1,GB_AK078900.1,GB_BC147705.1,GB_BC147718.1,GB_BC148391.1,GB_BC153014.1,
23+43dbEST_DV041294.1,dbEST_BY733060.1,dbEST_BY726473.1,dbEST_BY725557.1,REF_NM_177003.5,GB_AK145896.1,GB_AK165614.1,GB_AK036082.1,GB_AK163290.1,GB_AK078900.1,GB_BC147705.1,GB_BC147718.1,GB_BC148391.1,GB_BC153014.1,
34+45dbEST_DV041294.1,dbEST_AI843809.1,dbEST_BY733060.1,dbEST_BY726473.1,REF_NM_177003.5,GB_AK145896.1,GB_AK165614.1,GB_AK036082.1,GB_AK163290.1,GB_AK078900.1,GB_BC147705.1,GB_BC147718.1,GB_BC148391.1,GB_BC153014.1,
45+6dbEST_CJ072664.1,dbEST_CJ087033.1,dbEST_CJ077243.1,dbEST_CJ072772.1,
56+26dbEST_CF750286.1,dbEST_DV041294.1,dbEST_AI843809.1,dbEST_BY733060.1,REF_NM_177003.5,GB_AK145896.1,GB_AK165614.1,GB_AK036082.1,GB_AK163290.1,GB_AK078900.1,GB_BC147705.1,GB_BC147718.1,GB_BC148391.1,GB_BC153014.1,