NIA Mouse Gene Index (mm92)

Exon structure for U028025

chr6 -

Exon1 145198759 - 145198569
	GATTCGGCAggcggcggccgcggcggctgaggcggcagcgctgtggcggcggctgagacggcaggggaaggcggcggcggcTCGGCCCGGAGTCCCGCTC
	CCGCGCCATTTCGGACCCGGAGCGAGCGCGGCGCGGGCCTGAAGGCGGCGGCGGGAGCCTGAggcgcggcggctccgcggcgcggagagag
Exon2 145195336 - 145195215
	GCCTGCTGAAAATGACTGAGTATAAACTTGTGGTGGTTGGAGCTGGTGGCGTAGGCAAGAGCGCCTTGACGATACAGCTAATTCAGAATCACTTTGTGGA
	TGAGTATGACCCTACGATAGAG
Exon3 145182946 - 145182768
	GACTCCTACAGGAAACAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGT
	ACATGAGAACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAG
Exon4 145180774 - 145180615
	AGAACAAATTAAAAGAGTAAAGGACTCTGAAGATGTGCCTATGGTCCTGGTAGGGAATAAGTGTGATTTGCCTTCTAGAACAGTAGACACGAAACAGGCT
	CAGGAGTTAGCAAGGAGTTACGGGATTCCGTTCATTGAGACCTCAGCAAAGACAAGACAG
Exon5 145173717 - 145173594
	AGAGTGGAGGATGCTTTTTATACATTGGTGAGAGAGATCCGACAGTACAGATTGAAAAAAATCAGCAAAGAAGAAAAGACTCCTGGCTGTGTGAAAATTA
	AAAAATGCGTTATAATGTAATCTG
Exon6a 145169244 - 145166122
	GGTGTTGACGATGCCTTCTATACATTAGTCCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGGAAGAAGAAGAAGAAGAAGTCAAGGACAA
	GGTGTACAGTTATGTGAATACTTTGTACTCTTTCTTAAGGCACACTTAAGTAAAAGTGTGATTTTTGTACATTACACTAAATTATTAGCATTTGTTTTAG
	CATTACCTAATCTTTTTTTTTCTTCTGTTCGTGCAAACTGTCAGCTTTTATCTCAAATGCTTATTTTAAAAGAACAGTGGAAACCTTCTTTTTTCTAAGT
	GCCAGTATTCCCTGGGTTTTGGACTTAAACTAGCAATGCCTGTGGAAGAGACTAAAGACCTGAGACTCTGTCTTGGGATTTGGTGCATGCAGTTGATTCC
	TTGCTAGTTCTCTTACCAACTGTGAACACTGATGGGAAGCAGGATAATGAAGCTTCCGGACCATCCCTGCTCTGTGTCCATCTACTCATCCAATGGAGTC
	ATTAGCAGTCAATCGCCGCTTCACTGGACACTGAGGGGTCACAGACTTAGGCTCCCTTTGAGTCGCGTCCAGCGTGTCCTAGACTTTATCATCTTTCAGA
	GGCGTAGGCAGACTGTTCACAAAGGCTTTCTGTAGCTTTCCACTGCAATTAATCTTGGTCACTCCCTCAAATAGTATATTTTTTCTAGAAAAGGGGAAAA
	ATGGAAAAAAAAAGGCAATGGAAAATGTTGAAATCCATTCAGTTTCCATGTTAGCTAAATTACTGTAAGATTCCTATAATAGCTTTTCCTGGTAAGGCAG
	ACCCAGTATGAAATAGTAATAACCATTTGGGCTATATTTACATGCTACTAAATTTTTGTAATAATTCAAACAACTTTAGCATATATAAAAAGTTCTCATA
	AGAATTAAGTACAATTCCCCTTTGTCAGATTGTTCTTATCCTAACTTTCAAGTCTTTTTTGAATTTCTGTTGTTGAAAGTAGTTTTAATGGTTGTGAAGC
	TGAAGATGATCTGAGACAGTTATAGCTTGGCAGGTGTTGAGGAGACCAGAGTTGCAGGGTTGGGCCTTACGTGAACCTGTGACGAACGCTACTGGGTTTT
	GCAGCACTGCTGCATTCAATGTTGGCGACGCATTGTTTGGTCAACATAGGGGATAAGGAGACTTTGATGGCTTAGTATAATGCATTCTCACCATGTAACA
	GTCCTACTGACAAATCAAGAAATTTGtttataataataaaaaatttttaaaaatttCGATGTTCGCTTCAAGGTTGAGATTTTGGGGTAGGAGGCTACAA
	CAAGAGTAAATCTTAAAGCAAGGTTTTAAGAAGGTTTGAAAATGCAGGTTTGACTAGTCTCTCAACTCTAGCTAAACAAACATTCCCAAGTACTTCCCAA
	ATCTGATAGGTATTTAAAATTATCTAATGCTTTAAGAATAGTTAACAGGAAAAAAATCTCCTCAGTGCACTTAAAGCAACCCTTCACATCATTTGAAATG
	AGATGGAAATATCACTGGACTATGAGGACTGGATGTCTGTCTGATTTTAAGCAAATCACTGTCTGCTTGGTTTTGAATCATCTCAAAGACATTAACCTCC
	CAGCCGTGTAACATAGTTTACATGTTGACACACCTAGTTATCAAGCTCAGCACAATCTGTAACTGTTTTACATGGATTAACATCTTCACTGCCAGTCTTG
	GGCAAATTGTGCAAGAGGTAAAATTTATATTTCAGTATCCATTCTCCCATTTCAGGACTCCCCTCCAACATTATGCTGGCTTTCAGCCTGTCTCTCACCT
	GCCCATCACTTAGTGTAGTTTTAATAATTTCCCCCACTTCAAACTTTGTTTCCACTATGGACAACTTCATGAACTTTGCCCACTAAGGTAGGTACATCAA
	AGCTGCCCTATGGCTTTCTTCCCCGGGACTGAAAATAACAGACACCATAGTGGGATTTAAACTAATAGATGGTTTTCAGGGCCACTACAACAATTCAATC
	TCAATCCTTTGGACTTCATTCCTGCTGCCCAGGCCACTGGTGCCTCAGTAGGAATTTTCAAAATTAGTGTGAACAGACAGAGCACAGTCCAGTGGAAGGT
	GAGCTTAATCTTCATCTAGCCATCATCATGGTAAGTGATAGATTCTATTGTTTTAATAAATACAGTCTAACAATGAAAAACACTTCGAAGTTTCAATCAT
	AAAGCTGTCTTTTTAAAAATtttatttactcaacatttattcagtgcttgtcatattctgggaattacactaggcactcagggtgcggTGTCCTCAATCC
	TTGGCCAGTGGTATGTAGCATGATCTGTAATACCACTAAATAAGGCATATAGCATATGACTTAGACATAATGAAATACATGATTTGAGTTTTGCAGAGAG
	GAGTTTGGGTTTGTACATTCCCTTCCCCCCCAGTTTAGCAAGAATTGTTTGCTGTGAATCCAATGCAACTTTTAAATCAAACTACTTTATATAATTATTT
	CATTTTTCTAAAGGAACAGAAGTACCCTAAACTATTTTTTTGAAATGTTCTAAACTGTACATATTCATAGAACATTCTTTGGGTGAATTTTAAGTCTTAA
	AATGCAATTAGTAATACTTCTCATTTCTATTCAGAGGAACAGGTGTACTTCAAAAGCTGCAGTGTATAATCAGATATTTTTAATGGACAATGTGTTAAAG
	AAGTGGTAATTACCACTATGTAAATTTGAATTGTGTTACACTTTGGTTAACAAAAGGGGAAAGAATCCTAGAAACAAATATGTTATCTAGTTACTGCAGC
	CTTAAAGTCCTTGTTGAAGTTAAAAAGCAATGCTAAGTTACAGTCATAGGCATTAACATGTTTATGGGAAGGATATAGTAGGCAAATACAATTTGAGTAA
	ATATTTTCAGTAGGGAATTTTAGGCTCTACTGACTGAGTCACACTGCATAGGAATTTAGATCTTAACTTTTATAGGTTATCGACCTTTGCCACCATTGCA
	CAATTTTGTCCTAACATAAATACAAGTTCTGTGAGGCATGTCAAAAGTTACAGTTTGCATAAATTCATCTCATTTTGTATTCCACTGATTTTACATTTTC
	CTCAAacatacatacatacatac
Retained Intron 145166121 - 145166118
	atac
Exon7 145166117 - 145165219
	aacacacacacactcacacatGAAGGGTTTTTTTTTTGTAGGCAATAAAAATTTAACTAATTTCCATTTGTTAAAAAGTAGTGATTTATTGAGAATTATG
	CAGTCATTTTTTAAACCCAAAAGTTATTTAAAGGTGAATTTATACTCAATAACTTCTGTGTAATACTGGGTAGCATGAATTCTGCATTGAAAAATTGAAC
	AGATAATACCAATAGCTGTAAATTCTGTCAAAACATGAAAATTATTTCTAAAGAAGTACATTAGTTTTCAAAGAACAGTTATTAGAATCAGATCTGTGGT
	TTAGTTCAATAATTTGAAGTGCCTGTTTGGGATGGTGGTAGGCATTTTAGATGAATTTGGGAAAAATAAAGTTCTGCAGAAATGCCAGTTTCAGACCCCG
	CTAACCCGCTGAGTGGGCTGTGTGCTGTGTTAGCTCCAGTGCCCCAATCCCGTTTCATGTCTTCATGTTGAAACACTTCTGCATTTTTATTTGAGTGCCA
	ATTTCTTACTAGTGCTATTTCTTAGTGTAACATGTTTACCTGGGATGTATTTTAACTATTTTTGTATAGTGTAAACTGAAACATGCACATTTTGTACATT
	GTGCTTTCCTTCTTTCCATTCCTTTTCTTTCTGTtttgtttgtttgtttgtttgtttgtttgttATGGGACATATGCAGTGTGATCCAGTTGTTTTCCAT
	CCTTTGGTTGCGCTGACCTAGGGAATGTTGGTCATATCAAACATTAAATTTAAAAGTGACCACTCTTAATTAAAATTAACTTTTAAATGTTTATAGGAGT
	ACGTGCTGTGAAGTGATCTGAAATTTGTAATATTTTTGTCATGAACCGTACTGCTCCTAATCATTGTAATGTAATAAAAATAGTTATGGTGACTATGAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+51dbEST_CX225783.1,dbEST_BE287908.1,dbEST_BG918844.1,dbEST_CX207182.1,REF_NM_021284.6,GB_AK155064.1,GB_BC004642.1,GB_BC010202.1,GB_AK164065.1,GB_BC119495.1,
23+56dbEST_CN537570.1,dbEST_AI322494.1,dbEST_CX225783.1,dbEST_BI109744.1,REF_NM_021284.6,GB_AK155064.1,GB_BC141051.1,GB_BC004642.1,GB_BC010202.1,GB_AK164065.1,GB_BC119495.1,GB_AY487807.1,
24+1ENSMUST00000156486,
34+53dbEST_BI665434.1,dbEST_CN537570.1,dbEST_AI322494.1,dbEST_CX225783.1,REF_NM_021284.6,GB_AK155064.1,GB_BC141051.1,GB_BC004642.1,GB_BC010202.1,GB_AK164065.1,GB_BC119495.1,GB_AY487807.1,
45+5dbEST_AA518189.1,dbEST_BG247948.1,ENSMUST00000111710,ENSMUST00000111709,GB_BC119495.1,
56a+8dbEST_BU706307.1,dbEST_AA518189.1,dbEST_BE134695.1,dbEST_BX518153.1,GB_BC119495.1,
46a+51dbEST_BQ886983.1,dbEST_BI685329.1,dbEST_BI666498.1,dbEST_CN455681.1,REF_NM_021284.6,GB_AK155064.1,GB_BC141051.1,GB_BC004642.1,GB_BC010202.1,GB_AK164065.1,GB_AY487807.1,GB_X00485.1,
6a7+0