NIA Mouse Gene Index (mm92)

Exon structure for U028926

chr7 -

Exon1 108709379 - 108709328
	AACACTTGCTTTTAGAAGAGGACAGAGACCCAGCTGCCAAACATCTTCTCAG
Exon2 108704334 - 108704266
	CTGTTTTTTAACTTGACGATGACATCAAAAAATTTCAAGTTCTTCCTAACTTGGTGGCTAACCCAGCAG
Exon3 108703792 - 108703063
	GTGACTGGCCTGACAGGGTCTTTCACGCTAGACATGGCTCCAAATGCATTTGATGATCAGTATGAGAGCTGTGTCGAAGACATGGAGAAAAAGGCACCCC
	AGCTGTTACAAGAAGACTTCAACATGAATGAGGAATTAAAACTTGAGTGGGAAAAAGCAGAGATAAAATGGAAGGAGATCAAAAATTGTATGAGTTATCC
	GGCAGGTTTCCATGATTTCCATGGGACAGCTTTAGTTGCCTACACTGGGAACATCCACAGAAGCCTTAATGAGGCTACTAGAGAGTTCAAAATAAATCCT
	GGTAACTTCCACTACAAGGCCTTCCATTACTACTTAACAAGAGCTCTTCAGCTTTTGAGTGACCAGGGTTGTCGTTCAGTTTACCGAGGTACTAATGTCA
	GGTTTCGTTACACTGGGAAGGGCTCTGTGTGATTTGGGCATTTTGCATCCTCTTCTTTAAACCGGAGTGTAGCTACTTCTAGTCCATTTTTCAATGGACA
	GGGGACATTATTTATCATCAAAACCTGCTTGGGGGCTCACATCAAACATTGTTCCTACTATACTCATGAAGAGGAGGTGTTAATTCCAGGCTATGAAGTA
	TTTCACAAAGTCAAAACACAAAGTGTCGAACGGTATATCCAAATTTCTCTGGACTCCCCAAAAAGGAAGAAGAGCAACTTTAATTGCTTCTATAGCGGTT
	CTACTCAAGCAGCCAACGTTAGCAGCTTAG
Exon4 108701372 - 108700948
	GATCCAGAGAGAGCTGTGTATCCCTGTTCCTTGTGGTTCTCCTCGGTCTTCTGGTCCAGCAGCTTACTCTTGCTGAGCTGTAGCCCTCTCCTGTGTGCAG
	TTTGTGGGTGTGAGTGTTAAAGGGAGGCCAAGGGGGCAAGCCCTGATTGGTTGTTTAAGAACTGTGGAAGGGGGAAGGGTGGGGTTCTTTGAGGGGAGGT
	CTGCTTTAGCATTCATGACATCTATAAGCATCCAAGGTATCTTCTGGGTCTGTCTTGAAACTTTGCACTTTGACTTCAAATTACGACTCTTTCCACACTT
	TGCTATGATCAAAAAGCAATGTTTATCTGCCTCGTCAGCAGTAAGAGATTTAAAGTATGCAATTCGTGGTGAATTTTATAATCTAGGGAAATAAAAATTT
	ATAATCACAGCTTGCTTTATAACTA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+4dbEST_BY720728.1,ENSMUST00000173420,REF_NR_033804.1,GB_AK018555.1,
23+9dbEST_BY720728.1,ENSMUST00000173420,REF_NR_033804.1,REF_NM_007490.1,GB_AK018555.1,GB_BC120753.1,GB_AF016462.1,GB_AF016464.1,GB_X52991.1,
34+9ENSMUST00000173420,REF_NR_033804.1,REF_NM_007490.1,GB_AK018555.1,GB_BC120753.1,GB_S79913.1,GB_AF016462.1,GB_AF016464.1,GB_X52991.1,