NIA Mouse Gene Index (mm92)

Exon structure for U029420

chr7 -

Exon1 147302375 - 147302206
	GTCTTCATCCCGCCTGGGATCTGGGGCGGAGCGATTCTGCAGGCGGGGCGATTCTGTGGGCGGAACACATCGTCTCTCCGCCATGGCGGCCCTGCGTGCT
	CTGCTGCCCAGAGCCTGTAGCTCACTGTTGTCCTCAGTCCGCTGCCCAGAACTACGGCGCTTCGCCTCGG
Exon2a 147299032 - 147298878
	GTGCTAACTTTCAGTACATCATCACAGAAAAGAAAGGAAAGAATAGCAGCGTGGGGCTGATCCAGTTGAACCGCCCCAAAGCACTCAATGCACTTTGCAA
	TGGCCTGATTGAGGAGCTCAACCAAGCACTGGAGACCTTTGAGCAAGATCCTGCT
Exon2b 147298877 - 147298835
	GTGGGTGCCATTGTGCTCACTGGTGGGGATAAGGCCTTTGCAG
Retained Intron 147298834 - 147298446
	GTGTGCAGCCATGGTTGTGGATGGGAGGGGAATGCTAGGGCCTGTGGGAAGCAGCAAAATGGACCAGTTTCTCTGTGATGAGAGGGGTGCCTTAAGATAT
	ACTAACCTGTAAAGTAAGCTGTGTGGAAGAGCAGGGCATGTGTTGAACATTCAGGTATGCTCAGTTCCTTACTAGTCAGGTAAACACTGGTCTAAGCCGG
	TCCTCCTCTAAGTGTACCTGCCACCCACTGCCTGACACAGTCCTCAACATTACCTTCTTAAAACAGATGGCTTGGTGAGTTGTTGGTCCATGTCTCAGCT
	GTCCCCACTGTGGAGGGAAGTGCCCCCAAGCCTTGAGGACTGAGAAGTTCTTTAATGTCTGGTCATTGAACCCGCACTTCTACCCGTAG
Exon3a 147298445 - 147298379
	CTGGAGCTGACATCAAGGAAATGCAGAACCGAACATTTCAGGACTGTTACTCCAGCAAGTTCCTGAG
Exon3b 147298378 - 147298318
	CCACTGGGACCACATCACCCGGGTCAAGAAACCGGTCATCGCAGCTGTCAATGGTTATGCT
Exon4 147297694 - 147297595
	CTTGGTGGGGGTTGTGAACTTGCCATGATGTGTGATATCATCTATGCTGGCGAGAAAGCCCAGTTCGGACAGCCAGAAATCCTCCTGGGGACCATCCCAG
Exon5a 147296542 - 147296459
	GTGCTGGAGGCACTCAGAGACTCACCCGAGCAGTCGGCAAATCGCTAGCAATGGAGATGGTCCTCACTGGTGACCGCATCTCAG
Exon5b 147296458 - 147296438
	CTCAGGATGCAAAGCAGGCAG
Retained Intron 147296437 - 147296006
	GTGAGGTATCTGATGCTGGGAGCTGGGGAAGGCATAGGCTGCTTCAGGTGTCCCCGTGGGTAGCTGGTGTTGGAGCCCTAAGGTTCTGTCCTTAGCTTTT
	ATATCTTGAAATACATCATATACCAGAGAGTGGCAACATATGTTCAGGTTAGAAATAATAACAACATCTCTTTCCACTGCCTTTAAAAGCTCTTAAAGGC
	CAGCCTTTTTTCCTGCCCTTGCCAGTGACCACAGTCCTCAAGTCCTCTGTTCCATTTGATCCTGTAGACAGCATGTGACTGGAGCCCGTCAGTGGAGAGC
	CCAGAGTCACCCACTGCTGGGGACAGCCATCCCTTGTTAAGGACCCAGGGAACTGGCCTCTCGATGTCACTGGGTTCTAGAGGAAGTGGACAGGGATATT
	TCTGCATAATACTCAGACTTTTCATGTTTTAG
Exon6 147296005 - 147295886
	GTCTTGTAAGCAAGATTTTTCCTGTTGAAAAACTGGTTGAAGAAGCCATCCAATGTGCAGAAAAAATTGCCAGCAATTCTAAAATCGTAGTAGCCATGGC
	GAAAGAATCTGTGAATGCAG
Exon7 147294050 - 147293983
	CCTTTGAGATGACGTTAACAGAAGGAAATAAGCTGGAGAAGAGGCTTTTCTATTCCACCTTTGCCACC
Exon8 147292276 - 147291609
	GATGACCGGAGAGAAGGGATGACTGCATTTGTAGAGAAAAGGAAGGCCAACTTCAAAGACCACTGAGAACTGGCAGCTATACCGTTTGCCACCCTGGAAA
	GCTCAGCCTGTCCTTTGAGAGGCAAATAAATGATCCAAAAGGGTAGTAGTGTCGGCCACAGTTCCCACCGAAGGCTTCAGGGCTGTGGCCACAGCTTGGG
	TACTCATGGCGTGGCCTGCAGCCTTCACCAGTTGTTGGAAGTCAGGCTCACCCCGTCTTCTGAATCAGAAACCTGGGAAGCTTTCAAGGTGTCTTGATTT
	TTTTTTAACTTCACTGTAAGGGCAGGTGCACGCTTGGGCCAGCCACTCCCCTGTGCATTCTCCGCAGCTCATAGCTCAAGATGTGAGCTTCAAGAGGGAA
	GTGGCCCTCTCTGCTGATTCCCAACTCAAGAATTCAATGAAAGTAACTACTTCACAGTTTAGTTTCGACTCACCTGTAGTTGTCTCTAGAGAGCCAATGT
	GGTTTTTTAAAATTATTATTGCtattttcttatggctaaggtttcactgtgtatccctggctgcctggaagttactatatagaccaggttgaccttgaac
	tcacagagaccagccagtctctgttttccaagtgttgggattaaaggtgtatactaaccatgccgtaa

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12a+169dbEST_CD768133.1,dbEST_BU511381.1,dbEST_CA786842.1,dbEST_BU514743.1,REF_NM_053119.2,GB_BC072658.1,GB_BC033275.1,GB_BC026722.1,GB_AK088018.1,GB_BC002178.1,GB_AK167404.1,GB_AK040391.1,GB_AK044954.1,GB_AK086762.1,
13a+5dbEST_BY748411.1,dbEST_BY210751.1,dbEST_BY206062.1,ENSMUST00000151505,GB_AK154752.1,
2b3a+177dbEST_BU511381.1,dbEST_BI416132.1,dbEST_DV043362.1,dbEST_BF784634.1,REF_NM_053119.2,GB_BC072658.1,GB_BC033275.1,GB_BC057971.1,GB_AK088018.1,GB_BC002178.1,GB_AK167404.1,GB_AK040391.1,GB_AK044954.1,GB_AK086762.1,GB_AK210204.1,
2a3b+1ENSMUST00000125337,
3b4+129dbEST_BI415074.1,dbEST_CB947779.1,dbEST_BU511381.1,dbEST_BI416132.1,REF_NM_053119.2,GB_BC072658.1,GB_BC033275.1,GB_BC057971.1,GB_AK088018.1,GB_BC002178.1,GB_AK167404.1,GB_AK040391.1,GB_AK044954.1,
45a+112dbEST_BI415074.1,dbEST_CB947779.1,dbEST_CO810830.1,dbEST_BU511381.1,REF_NM_053119.2,GB_BC072658.1,GB_BC033275.1,GB_BC057971.1,GB_BC026722.1,GB_AK088018.1,GB_BC002178.1,GB_AK167404.1,GB_AK040391.1,GB_AK044954.1,
45b+1ENSMUST00000135842,
5b6+107dbEST_DV068188.1,dbEST_BI104968.1,dbEST_BI661965.1,dbEST_BI415074.1,REF_NM_053119.2,GB_BC072658.1,GB_BC033275.1,GB_BC057971.1,GB_BC026722.1,GB_AK088018.1,GB_BC002178.1,GB_AK167404.1,GB_AK040391.1,GB_AK044954.1,
67+71dbEST_AI194791.1,dbEST_AI303602.1,dbEST_DV068188.1,dbEST_BY761775.1,REF_NM_053119.2,GB_BC072658.1,GB_BC033275.1,GB_BC057971.1,GB_BC026722.1,GB_AK088018.1,GB_BC002178.1,GB_AK167404.1,GB_AK040391.1,GB_AK044954.1,
78+63dbEST_AI118154.1,dbEST_DV068188.1,dbEST_BY761775.1,dbEST_BI104968.1,REF_NM_053119.2,GB_BC072658.1,GB_BC033275.1,GB_BC057971.1,GB_BC026722.1,GB_AK088018.1,GB_BC002178.1,GB_AK167404.1,GB_AK040391.1,GB_AK044954.1,