NIA Mouse Gene Index (mm92)

Exon structure for U029509

chr7 -

Exon1 150646955 - 150646758
	GCGCGGGGGTGGGGCCAGCGCGTATAAAGGGGCGCAGCGGGCTGGGCGTTCCACAGGCCGAGTGCGCTGTGCTCGAGGGGTGCCGGCTAGGCCCGACTGA
	GAGCAAGCGAACAGGCAGGCAAGCTCCGAGGGGGCGCGGCCCAAGCTGGACAGGACAAGCGATCCAGACGCAGGAGCCGTCCATCACCAATCAGCCAG
Exon2a 150646621 - 150646584
	CCTTCGACCATGGGCATGTCCGACGTGTACCTCCGCAG
Exon2b 150646583 - 150646004
	CAGAACAGCGATGGAACGCTTGGCCTCCAGCGATACCTTCCCAGTGATAGCGCGTAGCAGCGCCTGCCGCAGCCTCTTCGGGCCTGTAGACCACGAGGAG
	CTGGGCCGCGAGCTGCGGATGCGCCTGGCCGAGCTGAACGCCGAGGACCAGAACCGCTGGGACTTCAACTTCCAGCAGGATGTGCCTCTTCGAGGCCCTG
	GTCGTCTGCAGTGGATGGAGGTGGACAGCGAGTCTGTGCCCGCCTTCTACCGCGAGACGGTGCAGGTGGGGCGCTGTCGCCTGCAGCTGGGGCCCCGGCC
	ACCCCCGGTGGCCGTGGCTGTCATCCCGCGTTCTGGGCCGCCGGCTGGCGAGGCCCCCGACGGCCTAGAGGAGGCGCCTGAGCAGCCGCCCAGCgcccca
	gcctcggccgtggtcgcggagcccaccccacccgcgaccccggccccggcttcagatctgacctcagacccaattccggaggtgaccctggtcgcgacct
	ccgacccgactccggacccgatcccggacgcgaacccggacGTGGCGACTCGGGACGGCGAGGAACAGGTCCCTGAGCAG
Retained Intron 150646003 - 150645932
	GTCTCTGAGCAGGGCGAGGAGTCGGGTGCTGAGCCGGGTGATGAGCTGGGAACTGAGCCGGTCTCTgagcag
Exon3a 150645931 - 150645700
	ggcgaggagcagggcgcagagccggtcgaggagaaggacgaggagccggaggaggagcagggcgcggagccggtcgaggagcagggtgcggagccggtcg
	aggagcagaatggggagccggtcgaggagcaggacgagaatcaagagcagCGCGGCCAGGAGCTGAAGGACCAGCCTCTCTCGGGGATTCCAGGACGTCC
	TGCACCCGGGACTGCTGCGGCCAATGCGAACG
Exon3b 150645699 - 150645664
	GTGCGATCAAGAAGCTGTCGGGGCCTCTCATCTCCG
Exon4 150645155 - 150645017
	ACTTCTTCGCCAAGCGCAAGAGAACTGCGCAGGAGAACAAGGCGTCGAACGACGTCCCTCCAGGGTGTCCCTCTCCAAACGTGGCTCCTGGGGTGGGCGC
	GGTGGAGCAGACCCCGCGCAAACGTCTGAGATGAGTTAG
Exon5a 150644926 - 150644836
	TTTAGAGGCTAACGGCCAGAGAGAACTTGCTGGGCATCTGGGCAGCGGACGATGGAAGAACTCTGGGCTTCGGCTGGGACCTTTCGTTCAT
Exon5b 150644835 - 150644242
	GTAGCAGGAACCGGAGATGGTTGCGTAGAGCAGCCCACGGTTTTGTGGAAATCTGAAAACTGTGCAATGTATTGAGAACACTCTGTACCATGTGCAAGGA
	GTACGCTGGTCCCAAGGTGTAAAGCTTTAAATCATTTATGTAAAATGTTTAATCTCTACTCGCTCTCAGTGCAAAACAAAAAGAGAAACTAGAAAATGTA
	GAACGAAGGAAAAAGATGAGAAAAAGGAAAAAGCATGTATATTTGTACAAAAAGTTAAAAAATTATGCTAATTTAATATTTGTATTTATCCATGCGTGGA
	TCCCTCTGCCACGCAACTGCTGGGTTATTGATTATTACCAAAGGCACTAGAAATCACCAGCTTCAGATTACCCACAAATGTAAATCTACTTTTATATTAG
	ACTCTAGGGGAATGGTTGTTGAGTAAAAGCCCCCACACATTCATCTTCAGTTAGCTTACAGTGTCCCCCACTTCATTAGATTGCTCTTAAACTTGGTGAC
	CAGACAGTCGAAATGGTTCCTGTACTGCCCATACCAACTGCCCAGGGCTCCTCGTCCGCCAGGTTCTAAATAAAGAGGCCCAACAAAAATCATA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12a+15dbEST_BQ573235.1,dbEST_CA984168.1,dbEST_BU513715.1,dbEST_CB180982.1,REF_NM_001161624.1,GB_U20553.1,
12b+77dbEST_AA002646.1,dbEST_W83506.1,dbEST_BI410757.1,dbEST_BI735151.1,REF_NM_009876.4,GB_AK077844.1,GB_BC005412.1,GB_U22399.1,
2b3a+2dbEST_BQ570931.1,dbEST_CB182816.1,
3a4+43dbEST_CX565034.1,dbEST_CD353266.1,dbEST_CB205803.1,dbEST_BI437888.1,REF_NM_001161624.1,REF_NM_009876.4,GB_AK077844.1,GB_AK132278.1,GB_BC005412.1,GB_U22399.1,GB_U20553.1,
3b4+27dbEST_CA978915.1,dbEST_CA977399.1,dbEST_CA980537.1,dbEST_BF161839.1,
45a+107dbEST_CF550902.1,dbEST_AA986859.1,dbEST_CB201648.1,dbEST_AV006483.2,REF_NM_001161624.1,REF_NM_009876.4,GB_AK077844.1,GB_AK132278.1,GB_BC005412.1,GB_U22399.1,GB_U20553.1,
5a1-1dbEST_CX565034.1,