NIA Mouse Gene Index (mm92)

Exon structure for U029751

chr8 -

Exon1 41601203 - 41601058
	gtgaagcagaggcaggtggctccctgtgagtGAGTGTGGAATCAACGAAAGAAGGAAGGAACAAACAAACCAGGGAGAAGACCACAAAGAGAAAGAAGAG
	GAGGGAGAGGAAGGGGAGGGTGAAGCCTATTCCCACGACAAAAGAG
Exon2 41598193 - 41598046
	TTTGACTACAATACAACAAGCAAACTCAAAAGACAACAGATAATGCAGATGGTTGTCTGGCAAGTCCTAAGTGTGGAGCCAAATAGAAGAAAGTGAGAAG
	TCTAAAGACTCTAACAATTACAAGACAGAAAGAGGTTATTGGAACAGG
Exon3 41597108 - 41596894
	GGCGTCATCAGGCCGCGCCCTCGGCGGGACGTGCGAGGAGCGACGTCGCCGCGCTGGGCCGAGCGCCGCTCCAGCTCCCCTTTCCCCCTTTCGCAGGGCG
	AGAGGCGTCTATGGGGCTCccgccgccgccgccggtaccgccaccgccaccgccgccgccgGGTGCTAGCTCTATGGCGAGGAGGAGGAGGAGGAGCGCG
	AGCTCAGAGACCCAA
Exon4 41595580 - 41595369
	GTGCATAAGTAAAGGGTAAAGTATTTTTATGACACAAATCTTCAATCAAGTATAACATTTTGATGCTCCACATCTAGACTCCTTGTGCTGTCACTATGCC
	AGCAGCAACCGTAGATCATAGCCAAAGAATTTGTGAAGTTTGGGCTTGTAACCTGGATGAAGAGATGAAGAAAATCCGTCAAGTTATCCGAAAATATAAT
	TATGTTGCTATG
Exon5 41593002 - 41592809
	GACACCGAGTTTCCAGGCGTTGTTGCAAGACCCATTGGAGAATTCAGAAGCAATGCTGACTATCAGTACCAACTGTTGCGGTGTAATGTAGACTTGTTAA
	AGATAATCCAGCTCGGACTGACCTTTATGAATGAACAGGGAGAATACCCTCCAGGAACGTCAACTTGGCAGTTTAACTTTAAGTTTAATTTGAC
Exon6 41586267 - 41586106
	GGAGGACATGTATGCTCAGGACTCTATAGAGCTACTAACAACATCTGGTATCCAGTTTAAAAAACACGAGGAGGAAGGAATTGAGACCCAATATTTTGCA
	GAACTTCTTATGACTTCAGGAGTGGTTCTTTGTGAAGGGGTCAAATGGCTATCATTTCACAG
Exon7 41584793 - 41584649
	TGGTTATGACTTTGGCTATTTAATCAAAATTCTGACCAACTCTAACTTGCCTGAGGAAGAACTTGATTTCTTTGAGATCCTTCGGTTATTTTTTCCTGTC
	ATTTATGATGTGAAGTACCTCATGAAGAGCTGCAAAAATCTCAAA
Exon8 41581269 - 41581159
	GGTGGATTACAGGAAGTTGCTGAGCAGTTAGAGCTGGAGCGCATAGGCCCTCAGCACCAGGCAGGATCTGACTCACTGCTTACAGGAATGGCCTTTTTCA
	AAATGAGAGAA
Exon9 41579469 - 41577894
	ATGTTCTTTGAAGATCACATTGATGATGCCAAATACTGTGGTCACTTATATGGCCTTGGTTCTGGCTCATCCTATGTACAGAACGGCACAGGGAATGCAT
	ATGAAGAGGAAGCCAGCAAGCAGTCATGACAGGAAATAGTCTTCTTATTTTTATTTTATACGAGTTACACACATGCTTGTATATAGGTTTTATCATCCCT
	TAAATAATAGGCAATACCCCCCCCCTTTTGTAGACCTTCTCTGCTTTCAGTAATAAGTATGGCCTTTCTTAGCTATGATCTTAATAAATTAAAGTACATT
	CAGGTTAAATCTGGCCTTAATTTAATACACTTCTTATCAAGCTTGTGTGACAAAGCTACATTACTGAATAATTTGATAAACTTTGCCTACTTGAGCTTGG
	TTTTGTTTTTCCCTTTTCCTAAATTAACTAGCATTGAGTGTAATTTATTTCCCTCTTCCATGCCTCTCCTTCTATTCTGCAGTACTTATAGGTATTTAAG
	ATTGTGGACCATCAAGTTTGCACTTTAGAGAGTGATTTCAATCCTCTATTTTATCAGAAATTGTGATTTTTCTTGCTCTTAGCTAGAAAAATAACCATCT
	ACCACCTTTTTACAGTATTTGCTTGTTTTTGACATTCAGAGTACAGCACGTGCATTGTGCAAATTGTTCAACAGGAATAACAGAAAAAGACAAGGAACTA
	CTGAAGAGCCTAGTAACTACTGTTTCTGTGTGTAGTGTTTAGCCTTCCAAGCACATCTCATGTCTGTTGGTTTCTAATTGGCATGCATAGGCTGCTATGT
	GACTGAAGAATTTCAAACCAGCTTTACACCCTTCAGGAAGAAGCCCTGTGATTGGCTATCTCCTCTCTGCCAGAAGGCTGGCCATTAAGATGTTGGAGCT
	CCAGTTTTATGACAGCACCGCCTCCCTTGATCGGCTTCCTTTTACTCCATCACTTTTACCCTTACTGTTTTATTTTATAAACATATTTATGATGTTCTTG
	ATTTGTTAACTACACAAATCAATTTCATTAAAGTCCAAAGATAACAAGTCTTAAGGTACATTTTATATCAATAAAAATACAAAATAAATGTGATTTCATA
	AATGCTACAAAAATAAATAATGGAGAGATTTGGTGCAAAACAACAAAATGCAAAAAATATATATAAATACACACATATATAGCTAATAAAATTACCTGAG
	GAGTGTAATGCTTGTTTATTTTTTTGTGTATATCTTTGCAATCTATTTTATATATATTGACAAGAGACTGTGAAATATTTAGCCATGCAGAATATGTGAC
	CAGACCAGAGCATGTGTTGGAAGATTTTGGTGAACATTAACTCTACCCTGAAGTGATGGACTACAAGTTGTAATGTGTGTTATCTACACTTCAATCGATA
	TTAGCAAGTCTCCAACTGTTAGCAACATAGTTCGTTTCCCTTGTACATTCTGTAAACATGATATGAAAATGCTGTACCTGGGCGGTCCTTTTTAAACTAA
	ACATTATTTGCAAAACAGAGGGTATTATTTGTTTTTAAAGCTTTTGTAAATAAAGGCTTCAAAAATGTTTTCCTAT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+3dbEST_CA557676.1,ENSMUST00000128237,NIA_K0231B07-5N,
34+106dbEST_AA896703.1,dbEST_AI020763.1,dbEST_AI930465.1,dbEST_AV482483.1,GB_BC006021.1,GB_AK147048.1,GB_AK009561.1,GB_AK137838.1,GB_AK166449.1,GB_AK132063.1,GB_AK007767.1,
14+12dbEST_BY719637.1,dbEST_CA561069.1,dbEST_CA559249.1,dbEST_CA557886.1,GB_AK135669.1,
24+3dbEST_CA557676.1,ENSMUST00000128237,NIA_K0231B07-5N,
45+119dbEST_AA797704.1,dbEST_AA672606.1,dbEST_AA896703.1,dbEST_AI020763.1,REF_NM_011135.4,GB_BC006021.1,GB_AK147048.1,GB_AK009561.1,GB_AK137838.1,GB_AK166449.1,GB_AK135669.1,GB_AK132063.1,GB_AK044535.1,GB_U21855.1,GB_AK007767.1,
56+67dbEST_AA217564.1,dbEST_AI020523.1,dbEST_BE306163.1,dbEST_BI456644.1,REF_NM_011135.4,GB_BC006021.1,GB_AK147048.1,GB_AK009561.1,GB_AK137838.1,GB_AK166449.1,GB_AK135669.1,GB_AK132063.1,GB_AK044535.1,GB_U21855.1,
67+52dbEST_AI851633.1,dbEST_AI877321.1,dbEST_AI020523.1,dbEST_AW764318.1,REF_NM_011135.4,GB_BC006021.1,GB_AK147048.1,GB_AK009561.1,GB_AK166449.1,GB_AK135669.1,GB_AK132063.1,GB_AK044535.1,GB_U21855.1,
78+38dbEST_AI851633.1,dbEST_AI877321.1,dbEST_AW764318.1,dbEST_BB702487.1,REF_NM_011135.4,GB_BC006021.1,GB_AK147048.1,GB_AK009561.1,GB_AK137838.1,GB_AK135669.1,GB_AK132063.1,GB_AK044535.1,GB_U21855.1,
89+31dbEST_AI851633.1,dbEST_BB702487.1,dbEST_BE281817.1,dbEST_BE655306.1,REF_NM_011135.4,GB_BC006021.1,GB_AK147048.1,GB_AK009561.1,GB_AK137838.1,GB_AK135669.1,GB_AK132063.1,GB_AK044535.1,GB_U21855.1,
79+2ENSMUST00000135269,GB_AK166449.1,