NIA Mouse Gene Index (mm92)

Exon structure for U029912

chr8 -

Exon1 72826388 - 72826222
	CATTCACGCGCCGGAAGCACTCATTTCTAGGTTCTCTGCCCGGGTCTGGAGCATGGCGGGGTTCGCTGAGATCGGGTTGTCGTCGTGGCTGGTAGAACAG
	TGTCGACAGCTGGGGTTGAAGCAGCCCACGCCGGTGCAGCTCGGGTGCATTCCGGCCATCCTGGAAG
Exon2 72825001 - 72824878
	GTCGGGACTGCTTGGGCTGTGCAAAAACAGGAAGTGGCAAGACAGCAGCCTTTGTGCTTCCCATCTTGCAGAAGCTGTCTGAGGACCCTTATGGCATCTT
	CTGCTTGGTTCTGACACCCACCAG
Exon3 72822065 - 72821980
	AGAGCTGGCCTACCAGATCGCTGAGCAGTTCCGGGTGCTGGGGAAGCCTCTGGGTCTGAAGGACTGCATCATTGTTGGTGGAATGG
Exon4 72821896 - 72821775
	ACATGGTGGCTCAGGCGCTGGAGCTCTCTCGGAAGCCACATGTAGTGATTGCCACCCCTGGGCGCCTGGCTGACCACCTGCGCAGTTCCAACACTTTCAA
	CATGAAGAAAATCCAATTCCTG
Exon5 72821217 - 72821030
	GTGATGGATGAGGCCGACAGGCTGCTGGAGCAGGGTTGCACCGACTTCACCACAGACCTGGAGACCATCCTGGCAGCCGTTCCAGCACGAAGGCAAACGC
	TGCTGTTCAGTGCCACGCTGACTGACACACTCAAGGAGCTGCAGGGCCTGGCCACCAACGAGCCCTTCTTTTGGGAGGCACAGGCCAC
Exon6 72820942 - 72820802
	AGTCCGCACAGTGGAGCAGCTTGATCAGCGCTATTTGTTGGTACCGGAGAAGGTGAAGGACGCCTACCTGGTTCACCTAGTCCAGACCTTCCAGGACCAG
	CTGGAGGACTGCTCCATCATCATCTTCACCAATACCTGCAA
Exon7 72820357 - 72820282
	GACCTGCCAGATCCTTTGTATGATGCTTCGAAAGTTCAACTTCCCCACAGTGGCACTGCACTCCATGATGAAGCAG
Exon8 72819550 - 72819474
	AAAGAGCGCTTTGCGGCCCTGGCCAAATTCAAGTCCAGCATCTATCGGATTCTTATTGCCACTGACGTGGCCTCAAG
Exon9 72819363 - 72819266
	GGGCCTGGACATCCCCACCGTGCAGGTGGTCATCAACCACAACACCCCTGGGCTTCCCAAGATCTACATCCATCGGGTTGGCCGCACAGCCCGTGCAG
Exon10a 72818734 - 72818661
	AGGTCCCTGGAGCTGATCAGCTGGGACAAGCCTGTTGATGGGGCCCAGGTTCTATGACAAATGTGTCCCCACAG
Exon10b 72818660 - 72818586
	GGAGGCAGGGGCAAGCCATCACACTGGTGACGCAGTATGATATCCACCTGTTGCATGCCATCGAGGAGCAGATCA
Exon11 72817986 - 72817898
	AGCAGCAGCTGGCAGAGCTGGTGGTGGAGGAGGCTGAGGTTCTACAAATCCTCACGCAGGTCAACGTAGTGCGAAGGGAGTGCGAAATA
Exon12 72817798 - 72817727
	AAACTGGAGGCTTCGCATTTTGATGAAAAGAAAGAGATCAACAAGCGGAAACAGATGATCCTGGAGGGGAAG
Exon13 72817586 - 72816765
	GACCCAGACCTGGAGGCCAAACGCAAAGCTGAGCTGGCCAAGATCAAGCAACAAAACCGACGCTTCAAGGAGAAAGTGGGGCAGACACTTCGGCGGCAGA
	AAGCAGGGAGCACTGTCCGACGGTCGCGTCCTCCCAGATCTCGGCCCCAAGAGCCAGCCCAGGCTGAGGCTCAGGACTGAGCTGTAAACCTGGTGCTGGT
	GGCCCCTGACTTCAGTAAACACTCTTTGAAGTTGTCAGTCTGACTTGAGAATGGGGTGGGATGAGTACAGGGCCTTCAGGTCTCAGGATCCCAAAGCCTC
	TGTTGCCCCATGGGGATGACTAGTGCAGCCTTCCCTCGCAGTGTCCCTGGGGCGCAGGGCAGCAGCAGCCAGGGACAGCAACGCCACACGTAGAAATGTA
	ACCTGGGTAGAAGCACTGCCCAAGGATTCTAGAAAACTCTACACAGTGCAAAGCTCAGAGACAGCTGGGGTCCCCTGGCCCCTGCCAGGGCGCCTTGAGG
	CCGCAGACACTCCATGGCAGACTAGGGTGCTGCCTCTGCCAGGCGTGCCAGGCCTTCACGCAGCTCGCTGAGCTCAAACAGCCGAACATCCAGCAGCTGC
	GCAGCCCGGCCCACCTCCGCCCGTGCGCGCTCCCGCTCGGCCCGCGCCTCCTCCAGGTTGCACTCCATCGACCGCAGCTGCTGCTCCAGCTCTGCATTCC
	GGGTCTCCAGGTCCTACACGGGGAAGACGGGGTGGGGTGGAAGCTCTGGTTGCCAGTTATGGCTGATGTGGCCCatggctctcaccgggtcagtaaagtg
	ccattaaagtgtgaagtactga

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+67dbEST_AA271508.1,dbEST_AI006137.1,dbEST_AI509061.1,dbEST_AV496678.1,REF_NM_001024922.2,GB_BC085301.1,GB_BC099554.1,GB_AK139073.1,
23+66dbEST_AA271508.1,dbEST_AI006137.1,dbEST_AV496678.1,dbEST_AV453275.1,REF_NM_001024922.2,GB_BC085301.1,GB_BC099554.1,GB_AK139073.1,
34+68dbEST_AA271508.1,dbEST_AA437815.1,dbEST_AI006137.1,dbEST_AV496678.1,REF_NM_001024922.2,GB_BC085301.1,GB_BC099554.1,GB_AK139073.1,GB_AK214595.1,
45+55dbEST_AV463107.1,dbEST_AV496678.1,dbEST_BF140299.1,dbEST_BF786436.1,REF_NM_001024922.2,GB_BC085301.1,GB_BC099554.1,GB_AK139073.1,GB_AK214595.1,
56+46dbEST_AL034707.1,dbEST_AV463107.1,dbEST_AW908553.1,dbEST_BF140299.1,REF_NM_001024922.2,GB_BC085301.1,GB_BC099554.1,GB_AK139073.1,
67+23dbEST_AI021635.1,dbEST_AW825082.1,dbEST_BF786352.1,dbEST_BI872367.1,REF_NM_001024922.2,GB_BC085301.1,GB_BC099554.1,GB_AK139073.1,
78+20dbEST_AA656069.1,dbEST_AI645047.1,dbEST_AI021635.1,dbEST_AW825082.1,REF_NM_001024922.2,GB_BC085301.1,GB_BC099554.1,
89+26dbEST_AA656069.1,dbEST_AI325878.1,dbEST_AI645047.1,dbEST_AI021635.1,REF_NM_001024922.2,GB_BC085301.1,GB_BC099554.1,
910a+2ENSMUST00000144890,GB_BC085301.1,
910b+24dbEST_AA656069.1,dbEST_AI586335.1,dbEST_AI325878.1,dbEST_AI645047.1,REF_NM_001024922.2,GB_BC099554.1,
10b11+25dbEST_AA656069.1,dbEST_AI586335.1,dbEST_AI116264.1,dbEST_AI325878.1,REF_NM_001024922.2,GB_BC085301.1,GB_BC099554.1,
1112+28dbEST_AI662691.1,dbEST_AI586335.1,dbEST_AI116264.1,dbEST_AI325878.1,REF_NM_001024922.2,GB_BC085301.1,GB_BC099554.1,
1213+30dbEST_AI662691.1,dbEST_AI586335.1,dbEST_AI327089.1,dbEST_AI116264.1,REF_NM_001024922.2,GB_BC085301.1,GB_BC099554.1,