NIA Mouse Gene Index (mm92)

Exon structure for U030186

chr8 -

Exon1 108375954 - 108375771
	GACTCAAAATAGGCGGTGGGAACGCGGTGCTCGCTGCTGCTTGAGCAGTTAGGAGGGGTGGGGTCCTGAACATGGCGGACCTCAGCTTTTCTGACGGCGA
	TCCTACTGTACGCACGCTTTTGCGGCGCGTGCTGGAGACGGCGGATTCGCGCACTCCGATGAGACGCCGGAGCACTCGGATCAA
Exon2 108374994 - 108374861
	acagggttcctctgtgtagtcctgactTTGGGGAGTGAAGCTTAAGGAGGGTTGTGAGCAGAAGGTACCGAAGTTGGCTTCCACCAGTCTGGAAGAATGC
	CCTTCTTTCCAAGTGGAGACTCGTTCATGATAAG
Exon3a 108373823 - 108373733
	TGCACAAAGAAGACGGTCTCAAACGCCATACTCTAACAGGCAGGGTAGCCAAACAAAGACAAGTGCTAGGAAGCAATCCCATGGAGCTAGG
Exon3b 108373732 - 108373688
	GTAAGTGTCCACCTACTCCATGAGTGACTTCATAGAACCCTAAAG
Exon3c 108373687 - 108373670
	TCTATTTTTGTTTTGAAG
Exon3d 108373669 - 108373614
	CCTACCTTGAGGGGCTCTCAAGCCAAAAGAGAGACTAGTGGCGCTTGTACCCATAG
Exon3e 108373613 - 108373526
	TCAGTTGGCAGATCGACTCGTGTTCAAGGTCGTGGGCGCCTGGAGGAACAGACACCCCGGACTCTGCTAAGGAATATCTTACTAACTG
Retained Intron 108373525 - 108373450
	GTAAGTGGGTGTCAGCCTGCCAGTTAAAATTAGGTGCTAGTCCAACAGTGAGTCCTATGATGTCCTTCTTGGTCAG
Exon4a 108373449 - 108373422
	CCCCACCCTTTTCTTGCTCATTCTATAG
Exon4b 108373421 - 108373325
	CCCCAGAATCGTCCACTGTGATGCCAGACCCAGTGGTGAAGCCAGCACAAGTACCAGAAGTGGCCCGGTCCTCCAGACGGGAGAGCAGTCGGGGAAG
Retained Intron 108373324 - 108373224
	GTACACGGTGAATTTCCCTCATAGGCTGAGCCACCTCTTGGGATCCCCAGAAACTAAAATTGGGCTTCCTGACATGTTTGAGATAAACTTCATCCTTACA
	G
Exon5a 108373223 - 108373087
	CCTGGAGCTACACCTTCCTGAACTGGAGCCCCCCTCAACCCTGGCTCCGGGTCTAACAGCCCCTGGCAAAAGGAAGCAGAAACTGAGATTATCAGTATTT
	CAGCAGGAAGTGGACCAGGGGTTGCCTCTCTCCCAAG
Retained Intron 108373086 - 108372956
	GTGAGATCTAGCACACACCTGAGCTATTTTCTCTCCGCTTGGGATATAGGAAAGACCCAAGAGAGCTTTCGTAGGCTTGGGTAACTCACTGTGGATTCTT
	TTTCTTACATTTTCTTGATGGAACCTGATAG
Exon6a 108372955 - 108372913
	AGCCACGTAGGAGTAGGAGTGCTGATGTTTCATCCTTGGCTAG
Retained Intron 108372912 - 108372800
	GTACTGTTCCCTGTTCTGGGGTTTATACAGTATGGTCACCAGATTCTAAGAGATAAGTCCCTTTGGGGAAGCTGTGTCTCAGGCTTTCCTTGTGTCTGCT
	TCCATCTTAACAG
Exon7 108372799 - 108372651
	CTCCTTCAATCTTACCTTTGTTCTACCTGGTCAGCCAGAGACAGTGGAGAGACCTGGTCTGGCTCGAAGACGTCCCATCCGCCAGCTTGTGAATGCTGGT
	GCTCTTTTGCAGGATCTGGAAGACAATTCCTTAGCCTCTGCTCTTCCAG
Exon8 108371078 - 108370884
	GTGACAGTCACAGAACACCTGTTGCTGCTCTGCCGATGGATGTAGGCTTGGAAGACACACAGCCTTTCTCACAGTCCTTGGCTGCCTTTTCCCTTAGTGG
	GAAACATTCTCTGCCCAGCCCTTCTCGCCCTGGGGTTGAAGATGTTGAAAGAGTTATGGGCCCACCAAGCTCGGGGACCAGGCTGCAAAGCCGGA
Exon9 108370700 - 108370548
	TGAGCAGATCTGGCCCTGCTGCCTCTCCTTCCCCCTTCCTGGAGCCACAGCCTCCGCCTGCAGAACCGAGAGAAGCAGTAGGATCCAACGAGGCTGCGGA
	GCCCAAGGATCAAGAAGGATCTTCAGGGTATGAGGAAACTTCTGCTAGGCCAG
Exon10a 108370291 - 108370216
	CAAGTGGAGAATTATCCTCCAGCACACATGACTCACTCCCAGCTGAACAGCCACCCCCGTCACCTGGAGTTGCAGT
Retained Intron 108370215 - 108370122
	GTAAGAAACCCCAGTTGTTGGGAAGAGGGTGCCCTGAAGTGGGCATTGTGCGCTTTCAAGTCCTCATAGCTATACGGATGATTGTCAAGCACAG
Exon11 108370121 - 108370065
	CAGCTCCAGCCTGTCTGCCGTCCTGGTGCCTGACCCAAGATGTGTAGAAGAGCTTAG
Exon12 108369336 - 108369160
	CCTATCTTCAGAGCCCCTGGAGTCTGTGACAGCTAAGTGCCCATCCAGGACCCAAACTGCAGGTCCTAGGCGCCGCCAAGACCCCCACAAGGCTGGACTG
	AGCCCCTATGTGAAGTTCTTCAGCTTCTGTACTAAGATGCCCGTGGAGAAGACGGCTCTTGAGATAGTAGAGAAGTG
Exon13a 108369078 - 108369012
	CCTAGACAAGTATTTCCAGCACCTTTGCAATGACCTGGAGGTATTTGCTTCTCATGCTGGCCGTAAG
Exon13b 108369011 - 108368974
	ATTGTGAAGCCAGAGGACTTATTGCTGCTGATGCGACG
Exon14 108368895 - 108368565
	GCAGGGACTAGTGACTGATCAAGTCTCGCAGCATGTGCTCGTGGAGCGGTACCTGCCCTTGGAGTACCGGCAACAACTTATCCCTTGTGCATTCAGTGGC
	AATTCTGTCTTCCCTGCACAGTAGGACCAGGCCTTCCCTGGCACCTACTCTCCCTACCTTGGAAATCTTGAACCCTACACAATCATGAAGGTTCCCTCAT
	CTCCTGGCACCAAGAAAGTCTCACAAATGGGTTCTTCTGCTTTGTGGTGCATGTCTTAGGACCTGCCCAGGTTGCCTTCCCCCAGCCTGGAAAGGAATAG
	GAATTAAAGACTTTATACTAGAAGAAAGTTA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+1dbEST_BB871167.1,
23a+1dbEST_BB871167.1,
13a+86dbEST_AA212307.1,dbEST_AA212322.1,dbEST_BB871146.1,dbEST_BB863797.1,REF_NM_177150.2,GB_BC100321.1,GB_AK143613.1,GB_AK089172.1,GB_AK090340.1,GB_AK167376.1,GB_BC121824.1,GB_AK182753.1,
13c+5dbEST_CF169226.1,dbEST_CF171375.1,GB_BC080832.1,NIA_B0810H04-5,
13d+3dbEST_BY161388.1,dbEST_BY018945.1,dbEST_BY162151.1,
3a3e+86dbEST_AA212307.1,dbEST_AA212322.1,dbEST_BB871146.1,dbEST_BB863797.1,REF_NM_177150.2,GB_AK143613.1,GB_AK089172.1,GB_AK090340.1,GB_AK167376.1,GB_BC121824.1,
3e4a+3dbEST_BY162890.1,dbEST_CK628027.1,dbEST_CX224360.1,
3e4b+99dbEST_AA212307.1,dbEST_BB871146.1,dbEST_BB863797.1,dbEST_BB872437.1,REF_NM_177150.2,GB_BC080832.1,GB_AK143613.1,GB_AK089172.1,GB_AK090340.1,GB_AK167376.1,GB_BC121824.1,GB_AK182753.1,
4b5a+82dbEST_AA509519.1,dbEST_AA212307.1,dbEST_AI613843.1,dbEST_BB871146.1,REF_NM_177150.2,GB_BC080832.1,GB_AK164039.1,GB_AK143613.1,GB_AK089172.1,GB_AK090340.1,GB_AK167376.1,GB_BC121824.1,
5a6a+47dbEST_AI047269.1,dbEST_AI613843.1,dbEST_AV466735.1,dbEST_AV585862.1,REF_NM_177150.2,GB_AK164039.1,GB_AK143613.1,GB_AK089172.1,GB_AK090340.1,GB_AK167376.1,GB_BC121824.1,
5a7+5dbEST_CF169226.1,dbEST_CF171375.1,GB_BC080832.1,NIA_B0810H04-5,
6a7+44dbEST_AA509519.1,dbEST_AI047269.1,dbEST_AI613843.1,dbEST_AV466735.1,REF_NM_177150.2,GB_AK164039.1,GB_AK143613.1,GB_AK089172.1,GB_AK090340.1,GB_AK167376.1,GB_BC121824.1,
78+27dbEST_AA509519.1,dbEST_AI613843.1,dbEST_AV466735.1,dbEST_BF719352.1,REF_NM_177150.2,GB_BC080832.1,GB_BC100321.1,GB_AK164039.1,GB_AK143613.1,GB_AK089172.1,GB_AK090340.1,GB_AK167376.1,GB_BC121824.1,
89+16dbEST_AV480842.1,dbEST_BI853531.1,dbEST_BI248784.1,dbEST_BY729053.1,REF_NM_177150.2,GB_BC080832.1,GB_BC100321.1,GB_AK164039.1,GB_AK143613.1,GB_AK089172.1,GB_AK090340.1,GB_AK167376.1,GB_BC121824.1,
910a+18dbEST_AV480842.1,dbEST_BI853531.1,dbEST_BI248784.1,dbEST_BY757248.1,REF_NM_177150.2,GB_BC080832.1,GB_BC100321.1,GB_AK164039.1,GB_AK143613.1,GB_AK089172.1,GB_AK090340.1,GB_AK167376.1,GB_BC121824.1,
10a11+2dbEST_CF580314.1,GB_BC080832.1,
10a12+16dbEST_AA265692.1,dbEST_AV480842.1,dbEST_BE447809.1,dbEST_BI853531.1,REF_NM_177150.2,GB_BC022690.1,GB_AK164039.1,GB_AK143613.1,GB_AK089172.1,GB_AK090340.1,GB_AK167376.1,GB_BC121824.1,
1112+4dbEST_CF580314.1,dbEST_DT928933.1,dbEST_W99237.1,GB_BC080832.1,
1213a+59dbEST_AA517339.1,dbEST_AA116458.1,dbEST_AA271876.1,dbEST_AA104595.1,REF_NM_177150.2,GB_BC022690.1,GB_BC080832.1,GB_BC100321.1,GB_AK164039.1,GB_AK143613.1,GB_AK089172.1,GB_AK090340.1,GB_AK167376.1,GB_BC121824.1,
1213b+1dbEST_AI852614.1,
13b14+87dbEST_AA049348.1,dbEST_AA517339.1,dbEST_AA116458.1,dbEST_AA271876.1,REF_NM_177150.2,GB_BC022690.1,GB_BC080832.1,GB_AK164039.1,GB_AK143613.1,GB_AK089172.1,GB_AK090340.1,GB_AK167376.1,GB_BC121824.1,