NIA Mouse Gene Index (mm92)

Exon structure for U030991

chr9 -

Exon1 63869866 - 63868012
	AGACTGGCATATGATGGGAGGCAGCCAATGACTCCGCGGCGCTCCTCCGGGGGCCCTCAGTGTGCGTTTGAGGAGAACAAAAAAGAGAGAGAGCGCCGAG
	AGGGGGAACGAGCGAGGGAGCTGAGTCCAGAGAAAGAGCCGCCGGGCGCTGCCTCGCCAAACCTCGCTGGGACCGCGGGGCCACCAGGAGGCACTTTGGT
	GAAGGGGGGGGGGGGCGACCTCGGCAGCCGCGGCGCCCGAAGCGACCCAGCGCAGCGTGGGGCGGGCTGCGACCTCTGCTTCGGTGGATTGCATTTTTAA
	TTAAGGATTCCTAGCAGCTCTTTGGGATTTTTTTTTTCCGGCTTCCACTCATGTGTTGACACCCGCGTTCAGGAGAGACTTGCCCCAAGTGCACCGAGCG
	CCCGGGACCTGAGACGGAATTGCTTTTCGTGCGTGCAAAATCCAAGCATTTTGAGTTTTGTTTGGGACCTTTTTCTTGCTTTGCTTTTATTTCTATTTTT
	ATTTTGTTGCAGGGATATGGGAGTTATCCACAAGCCTTAGTTTCGGATCCTGCAGGGAAAGCCCATGTAGCATAGCTTGGCTTTTGAAGGCAGAGTTGTG
	CAGACACATTTGGGGGCACGACGCAAGCGCTTTGTGCTCGTGTACCAGCCGCGCAACTTTTGAAGGCTCGCCGGCCCATGCAGGGTGTCTCTAGCATCGT
	TTCGCTGGTGGCTTCCCTAAGGCTCCAAAGCAGCTGGAGTTGAGCGGTCCCGGCCCATCGTGATCCATGTAGCCCGCTGGTCCCTCGCGGACTGAGGCTC
	AACACGCGCGTGTTcccggcccggcccggcccggcttggcccggcGCGAGCTCCCTCATGTTGCAGCCCTGCGGTGCCCCTTCGACGACAGGCTGTGCGC
	GGTCTGCACGGCGCCCCGCGGCAGAGCTTCATGTGGGGCTGCGGCCCGCTCAGCCGGCGCCTCGTTGAGGGAACGGACCCCCGGTAACCGGAGACCGCCT
	CCCCTCCCACCACCCCAGGCGCCAAAGGGTATCGTATGTTCAGGTCTAAACGTTCGGGGCTGGTGCGGCGACTTTGGCGAAGTCGTGTGGTCCCTGATCG
	GGAGGAAGGCAGCGGCGGCGGCGGTGGTGTCGACGAGGATGGGAGCCTGGGCAGCCGAGCTGAGCCTGCCCCGCGGGCACGAGAGGGCGGAGGCTGCAGC
	CGCTCCGAAGTCCGCTCGGTAGCCCCGCGGCGGCCCCGGGACGCGGTGGGACCGCGAGGCGCCGCGATCGCGGGCAGGCGCCGGCGCACAGGGGGCCTCC
	CGAGGCCCGTGTCGGAGTCGGGGGCCGGGGCTGGGGGCTCCCCGCTGGATGTGGCGGAGCCTGGAGGCCCAGGCTGGCTGCCTGAGAGTGACTGCGAGAC
	GGTGACCTGCTGTCTCTTCTCCGAACGGGACGCAGCAGGCGCGCCCCGGGACTCTGGCGATCCCCAAGCCAGACAGTCCCCGGAGCCGGAGGAGGGCGGC
	GGGCCTCGGAGTCGCGAAGCCCGCTCGCGACTGCTGCTTCTGGAGCAGGAGCTCAAGACGGTCACGTACTCGCTGCTCAAGAGGCTCAAGGAGCGTTCGC
	TGGACACGCTGTTGGAGGCTGTGGAGTCCCGAGGCGGCGTACCGGGCGGCTGCGTGCTGGTGCCGCGCGCCGACCTCCGCTTGGGCGGCCAGCCCGCGCC
	ACCGCAGCTGCTGCTCGGCCGCCTCTTCCGCTGGCCAGACCTGCAGCACGCAGTGGAGCTGAAACCCCTGTGCGGCTGCCACAGCTTTACCGCCGCCGCC
	GACGGGCCCACGGTGTGTTGCAACCCCTACCACTTCAGCCGGCTCTGCGGGCCAG
Exon2 63864794 - 63864640
	ACCCCCGGGAGAAAAAAAAAGTCGGAGGTCCAGGCCAGCATGTGGATCTTGTTCTACAGCAAAGAGCTGCCCTGCAAAGATGGGTGGAAAGTATCAAATG
	GAAACCCCCGCCAGGCGCAGAGAGGCTGTGAACTTTTTTCTGGCCTCAAATGAAG
Exon3 63860078 - 63860022
	AATCACCGCCGCCCCCCTATTCTCGGCTGTCTCCTCCTGACCAGTACAAGCCACTGG
Exon4 63855415 - 63855338
	ATCTGTCCGATTCTACATTGTCTTACACTGAAACCGAGGCCACCAACTCCCTCATCACTGCTCCGGGTGAATTCTCAG
Exon5 63837357 - 63837279
	TTAAATTTAAAAAGGAAGTGAGCCCCTGTGAGCAGACAGATAGGACCACGTGGCCCAGGAGGGCAAGCATAAAAGAATG
Exon6 63801863 - 63800883
	ATGCCAGCATGTCTCCGGATGCCACCAAGCCGAGCCACTGGTGCAGCGTGGCGTACTGGGAGCACCGGACACGCGTGGGCCGCCTCTATGCGGTGTACGA
	CCAGGCTGTCAGCATTTTCTACGACCTACCTCAGGGCAGCGGCTTCTGCCTGGGCCAGCTCAACCTGGAGCAGCGCAGTGAGTCGGTGCGGCGCACGCGC
	AGCAAGATCGGTTTTGGCATACTGCTCAGCAAGGAGCCAGACGGCGTGTGGGCCTACAACCGGGGCGAGCACCCCATCTTCGTCAACTCCCCGACGCTGG
	ATGCGCCCGGAGGCCGCGCCCTGGTCGTGCGCAAGGTGCCACCGGGTTACTCCATCAAGGTGTTCGACTTTGAGCGCTCAGGGCTGCTGCAGCACGCAGA
	CGCCGCTCACGGCCCCTACGACCCGCACAGTGTGCGCATCAGCTTCGCCAAGGGCTGGGGACCCTGCTACTCGCGACAGTTCATCACCTCCTGCCCCTGT
	TGGCTGGAGATCCTACTCAACAACCACAGATAGCAATGCGGCTGCCACTGTGCCGCAGCGTCCCCCAACCTCTGGGGGGCCAGCGCCCAGAGACACCACC
	CCAGGGACAACCTCGCCCTCCCCCCAGATATCATCTACCTAGatttaatataaagttttatatattatatggaaatatatattataCTTGTAATTATGGA
	GTCATTTTTACAACGTAATTATTTATATATGGTGCAATGTGTGTATATGGAGAAACAAGAAAGACGCACTTTGGCTTGTAATTCTTTCAATACAGATATA
	tttttttctttctttccctctttccttttttAAAGAGAATTATACAGTAGAACTAGGTGGAAAGCCTAGGTTTGGTGTATGGCTTTTTTAAAAAATATTA
	ATGCCCAGACCAAAAAAAAACAAAACAAAAAACAAAAAAACTAATACCAGTCACTCTTGATAATAAAGTGTTTGCATTATA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
23+2dbEST_BF149694.1,ENSMUST00000144323,
13+8dbEST_BI685522.1,ENSMUST00000041029,REF_NM_008542.3,GB_BC047280.1,GB_AK046602.1,GB_AK004671.1,GB_AF010133.1,GB_AB221689.1,
34+11dbEST_AA451501.1,dbEST_BI685522.1,dbEST_BF149694.1,ENSMUST00000041029,REF_NM_008542.3,GB_BC047280.1,GB_AK046602.1,GB_AK004671.1,GB_AF010133.1,GB_AB221689.1,
45+1dbEST_BF149694.1,
46+11dbEST_BI659871.1,dbEST_BG804416.1,dbEST_AA451501.1,dbEST_BI685522.1,REF_NM_008542.3,GB_BC047280.1,GB_AK046602.1,GB_AK004671.1,GB_AF010133.1,GB_AB221689.1,
56+2dbEST_BF149694.1,ENSMUST00000144323,