NIA Mouse Gene Index (mm92)

Exon structure for U031344

chr9 -

Exon1a 108976638 - 108976612
	AGGCTGGGGAGACGCTGGAAGGCGAGG
Exon1b 108976611 - 108976269
	GGAACGGCGGCGCGCGGGCGGTTGGGCCAGCTCAGGCTTTCTGTGGACAAGGCTGTGCTTGGCGTCTTCGGATGCTGCGGGTTGAAGGTAGTCATGGCCG
	GGACCCCCGCACCGAACAGCCACAGGAAACAGAGTGGCGGCCTGGAGCCTTTCCCCGGTCTGTCTCGATCCATTGAGAACCCTCCGAGCAAGCGGGCCCG
	GAGCTTCTCTGAGACCACAGTCCCGGACCCCGAAGACCCATTCGGTGAGCACGCGGAATTTACTGCGGACGACCTAGAGGAACTCGACATCCTCGCGTCA
	CAGGCCCTGAGCCAGTGTCCCGTCGCGCCTCGGAACCTGTCCA
Exon1c 108976268 - 108976173
	GTGAGTGCCTGAGGGGCCTTTTCCCCCGGCGGGTGGTGCAGACCTCTGATTTGGCGGTGAGACATCCAGAATGTTAAATGGCCTCCCATTTAGATG
Exon2 108975251 - 108975121
	GTGCTCATAAGGTCCGCCGATTAGATGGGTTACCAAATAGTCCTATAAGGAAAAGCAGAGAAGATATTCCAGTTAAAGATAATTTTGAATTAGAAGTACT
	TCAGATACAATACAAAGAACTTAAAGAAAAG
Exon3 108974402 - 108974232
	CTGAAAGCAATGGAAGAAGAAATCCTAATTAAGAATGGAGAAATTAAAATTTTGCGTGACTCTCTGCGTCAGACAGAATCCGTTCTAGAAGAACAGAAAA
	GATCACATTTCCTTCTTGAGCAAGAAAAGACTCAAGCACTCAGTGAAAAGGAAAAGGAATTCTCCAGAAAG
Exon4 108971911 - 108971793
	CTCCAATCACTGCAGTCTGAACTGCAGTTTAAAGACGCAGAAATGAATGAGTTAAGGACAAAGTCTCAGAGCAACGGACGAACAAATAAGCCAGCCGCTC
	CCTCCGTCTCCCACGTCAG
Exon5 108970424 - 108970267
	TCCTAGGAAAGGCTCTTCTGTGGTTCTCAAGTCAGAAGCATGTTCTCCACATGTTGGAAAAACAACTTTCCCTACAAAAGAATCTTTTAGTGCTAACACG
	CCTCTCTTCCACCCCTGTCAGACTGAGGCAGGACACAGATTTCTGGTGGGCCAAGAGG
Exon6 108969632 - 108969531
	TTTCAGATAATAAAAACCACAGTCTGGGAGGTAGCCTCATGAAGCAAGATGTGCAGCAGAGAATTCTGGCTGATGGCTGGATGCAGAGAAAAGATGCTCA
	AG
Exon7 108968606 - 108968480
	GTTCTATTTTGATAAACTTGCTCCTGAAGCAACCTTTGGTGCCAGGGTCATCTCTAGGTCTTTGTCACCTTCTGAGCAGTTGTCCTGAGGTTCCTACTGG
	CACCCTCTTGCAGCCACCAGGGCTCAG
Exon8a 108968313 - 108967727
	TACTTTGCCTGGGACTTCAGGCCTCAGGACCATCAGTTCTTCTGATGGGCCATTTTCCCCCTCTGCCCTGAGAGAAGCACAGAACTTGGCATTCACTGGA
	TTAAATCTGGTTGCCAGGACTGAGAGCTCACATGATGGAGACATGGCAGGCAGAAGAGTCTTCCCGCTCCACCAGCTTCCTGGAGCTGTGCATCTCCTTC
	CTCTTGTGCAGTTTTTCGTCGGCTTACACTGCCAGGCTCTGCAAGATTTAGCCCCAGCTAAGAAGAGTGGGGTGCCTGGGGACTCTGCGACACATACCTC
	CTGCATGAGCTCTGGGGTCGAGGCTAGCCCAGAGGACTCCATTCATGGCTTGGAGAGCTTTTCTGTGGCATCACTCAGCGTCCTTCAGAACCTGGTGTGC
	CACAGTGGGGCAGTTGTCTGCCTGTTACTGTCAGGCATGGGGACAGAAGCTGCCGCCAGGGAAGGAAACTTGGTCCAGACTTGTGCAGATACAACCTCAG
	CCTCCAGGGAGGATGCTCATGACCAAGACCAGCACCCACTGCTAAAGATGCTTCTTCAGCTGATGGCTTCCTCCTCTGCAGCATCAG
Exon8b 108967726 - 108967642
	GTCATTTTCAAGCCAGTGTCCTGGGCCTGTGCCTCAAAGTTTTGGTGAAATTAGCAGAAAACGCTTCCTCTGATTTGTTGCCCAG
Exon9 108964182 - 108964046
	GTTCTCCTGTGTGTTCCCGGTGTTGCCACAGTGCCTCGGCTCAGCGCTGCCGCTGCCCTGTGTGCTCCTGGCTGTTGAGCTGCTCTCTGTGCTGCTGGAC
	CATGACAGCCTAGCATGGCAGCTATGCTCCCACCCAG
Exon10 108963715 - 108963624
	AAGGCTGCCTTCTCCTGAGGCTGTACATGTACATCACATCAAGGCCTGACAGAACGGCCTCAGAGACACAGTGGCTTCAGCTGGAACAAGAG
Exon11 108963223 - 108963143
	GTAGTATGGCTCTTGGCCAAGCTGAGTGTACAGAGCCCTGCCCCCGCTGGCATTGGTTCTGACTGTCACTGCAATGTAGAG
Exon12 108963026 - 108962777
	GCAGTCAGAGCGCTCACTGTGATGTTGCACAGGCAATGGCTGACGGTGCGGCGGGCAGGAGGTCCAAGGACCCACCAGCAGAAGCAGACGATACGCTGTC
	TGCGGGACACTGTGCTGCTGCTGCATAGCCTATCTCAGAAGGACAAGCTCTTCACTGTGCACTGTGTCGAGGTCCTGCATCAGTACGACCAGGTGATGCC
	AGGGGTCAGCATGCTGATTCGAGCCCTTCCTGATGTGACTGACTGTGAAG
Exon13a 108962422 - 108962332
	AGGCTGCCCTGGATGACCTCTGTGCTGCGGAGACTGATTTGGAAGACTCTGAGATGGACTGTAACTGAGGGCCTGAGCATCCAGCCACAAG
Exon13b 108962331 - 108962161
	GTGGCGCCAGCTCCCACCGCCGTCTTTGCCATATCCACTGATTAAAACTGCACTTCCTGCTGAGAACACAAGCTTTGTTTCCTGAGTCCGATTTGTGTGG
	CTGAGAGGGAGGGACAGGGCAGACCAAGAATTGATGAGATGACTCCTGCTGGAGTTGAGATGGCCCCCATG
Exon13c 108962160 - 108961703
	GTAACTGATCTGCCCTGAGGAAAAACCCTGCCCCTCTTCGGGAATTACCCTGAGTCATAGCTTTGGGCGGGGGCCGTGGTGGGGGCAGGGGTACGTTTGT
	GGCCAAGGAGGCAGCCCTTTTTAGGAAGGCCTGGATCAAGGACTGGGGGAAAGACAAGAAAAGGCAGAGGCTCACGGGCACATTTGAATCCTAGAGACAA
	CCCAGTTTGAGTTGTCAGTGTTGGGGCAGTAGTCCATTTTACCAGCCAGCAGGATCACAGATATGGATCTAGGAAGGCCTTTGGGGTGCTTGGGGAGGGA
	GGGAGGAGCGTCAGCACGAGGGCCAGGCCTGGCAGGCTAACAGCAGGGCGGGCCCTGTTCAGGAGGCAGGCCTATGGGTGGACCCAGGCAGTTTTACTTC
	CTCAGCCACACTGCTGCCAGCAGCAGACCCAGCGGAGTGCCTTGCTGCCTGCTTCTCG
Retained Intron 108961702 - 108961443
	GTAAGTGTGGAGTAAGGGTATGGGGTAAGGCAGAAGAGAATAGGGTTCCCTCACCCTGAAGGTAGTCAGCACTAGGGGAAGGGCCTCCCTCAAAAGGCAA
	ATAAGTAGTGGATCCATCCCACTAGAACAACCCTGCCCTCCAGCTTCTAGTGGCCCTGGATAGTACCTGCTGAAGGGAAGGGCTGAGCTGCCTTTCTGCA
	CCCCACCTCAGCCCACTTGAGACCTTCCTGCTGCTACTCATTACCCCATCTCCTCCCCAG
Exon14 108961442 - 108960446
	GTTCAGCATGGGCTCACAGACCCTGCCCCATGGTCACATGCAGACCCTCATCTTCTTAGACCTGGAAGCCACTGGCCTGCCTTCGTCTCGGCCCGAAGTC
	ACAGAGCTGTGCCTGCTGGCTGTCCACAGACGTGCTCTGGAGAACACTTCCATTTCTCAGGGACATCCACCTCCAGTGCCCAGACCGCCCCGTGTGGTGG
	ACAAGCTCTCTCTGTGCATTGCTCCAGGGAAAGCCTGTAGCCCTGGGGCCAGTGAGATCACAGGTCTGAGCAAAGCTGAGCTGGAAGTACAGGGGCGTCA
	ACGCTTCGATGACAACCTGGCCATCCTGCTCCGAGCCTTCCTGCAGCGCCAGCCACAGCCTTGCTGCCTTGTGGCACACAACGGTGACCGCTATGACTTT
	CCTCTGCTCCAGACAGAGCTTGCTAGGCTGAGCACTCCCAGTCCCCTAGATGGTACCTTCTGTGTGGACAGCATCGCTGCCCTAAAGGCCTTGGAACAAG
	CTAGCAGCCCCTCAGGGAATGGTTCGAGGAAAAGCTACAGCCTGGGCAGCATCTACACCCGCCTGTACTGGCAAGCACCGACAGACTCACATACTGCTGA
	AGGTGATGTTCTAACCCTGCTCAGCATCTGTCAGTGGAAGCCACAGGCCCTACTGCAGTGGGTGGACGAACATGCCCGGCCCTTTAGCACCGTCAAGCCC
	ATGTACGGCACTCCGGCTACCACTGGAACAACCAACCTAAGGCCACATGCTGCCACAGCTACTACACCCCTGGCCACAGCCAATGGAAGTCCCAGCAATG
	GCAGGAGCAGGCGACCTAAGAGTCCTCCTCCAGAGAAGGTCCCAGAAGCCCCATCACAGGAGGGGCTGCTGGCCCCACTGAGCCTGCTGACCCTCCTGAC
	CTTGGCAATAGCCACTCTGTATGGACTCTTCCTGGCCTCACCTGGGCAGTAAGTCAAGAGGGGAAATATGATGAATAAAGACTTCCATAGCACTGAC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1b2+46dbEST_DV047835.1,dbEST_BQ886055.1,dbEST_BQ924097.1,dbEST_CA326795.1,REF_NM_172774.3,GB_BC078458.1,GB_AK031257.1,GB_AK171423.1,GB_AK020102.1,
1c2+2dbEST_CD350495.1,ENSMUST00000160928,
23+38dbEST_CF586538.1,dbEST_DV047835.1,dbEST_BQ886055.1,dbEST_BQ924097.1,REF_NM_172774.3,GB_BC078458.1,GB_AK031257.1,GB_AK171423.1,GB_AK189287.1,
34+19dbEST_CN459548.1,dbEST_CF950362.1,dbEST_CF586538.1,dbEST_BQ886055.1,REF_NM_172774.3,GB_BC078458.1,GB_AK031257.1,GB_AK171423.1,GB_AK189287.1,
45+20dbEST_CN455485.1,dbEST_CF950770.1,dbEST_CN459548.1,dbEST_CF950362.1,REF_NM_172774.3,GB_BC078458.1,GB_AK031257.1,GB_AK171423.1,
56+15dbEST_CN455485.1,dbEST_CF950770.1,dbEST_BQ830418.1,dbEST_CN459548.1,REF_NM_172774.3,GB_BC078458.1,GB_AK031257.1,GB_AK171423.1,
67+15dbEST_BF120195.1,dbEST_CN455485.1,dbEST_CF950770.1,dbEST_BQ830418.1,REF_NM_172774.3,GB_BC078458.1,GB_AK031257.1,GB_AK171423.1,
78a+14dbEST_BF120195.1,dbEST_CN455485.1,dbEST_CF950770.1,dbEST_BQ830418.1,REF_NM_172774.3,GB_BC078458.1,GB_AK031257.1,GB_AK171423.1,
8b9+13dbEST_AW492450.1,dbEST_DT917760.1,dbEST_CX226182.1,dbEST_BM947219.1,REF_NM_172774.3,GB_AK031257.1,GB_AK215726.1,GB_AK216850.1,
8a9+2ENSMUST00000160217,GB_BC078458.1,
910+15dbEST_BI134613.1,dbEST_CA876488.1,dbEST_BB038463.2,dbEST_BF182577.1,REF_NM_172774.3,GB_BC078458.1,GB_AK031257.1,
1011+22dbEST_BI134613.1,dbEST_CA876488.1,dbEST_BB375981.2,dbEST_CV675054.1,REF_NM_172774.3,GB_BC078458.1,GB_AK031257.1,
1112+26dbEST_BX633090.1,dbEST_BI134613.1,dbEST_BY604363.1,dbEST_CJ321014.1,REF_NM_172774.3,GB_BC078458.1,GB_AK031257.1,
1012+1ENSMUST00000161521,
1213a+44dbEST_CX205626.1,dbEST_BB386077.2,dbEST_BX633090.1,dbEST_BI134613.1,REF_NM_172774.3,GB_BC078458.1,GB_AK031257.1,
13a14+2dbEST_CX205626.1,ENSMUST00000128062,
13c14+18dbEST_BY709494.1,dbEST_BB666697.1,dbEST_CA323364.1,dbEST_BY344133.1,REF_NM_001012236.1,GB_AK009899.1,GB_AK087832.1,
13b14+5dbEST_AA242227.1,dbEST_AA197643.1,ENSMUST00000061973,REF_NM_011637.6,GB_AF151106.3,