NIA Mouse Gene Index (mm92)

Exon structure for U032552

chr11 -

Exon1 20149432 - 20149310
	GTGGCGGGCGCCTGGCCCTCCCTCCCCAGGAGTGCGGGCGCCCGCGGGAGGCCCCGTCGTCGCCGCCTGGGACCCTGGCCCAGCTACGCGGGTCGCTCGG
	GACGTGCGGCGGTGTGGAGTGAG
Exon2 20142241 - 20141889
	GTTCCTGAAGGCTTCAAAGGAAACCTGATAGAGGAGGCTCAATGGCCCTGAGTGAAGATGAGGCTGAGGCAGAAGTGTCTGTCAACACAAAGGTCCCATC
	CTGTGGCAGGTGGAACTCTGGGAAGCTGCTGCCCTCAGGGCTTGAACCAGATCAGCCCCTACATCTGGGTGTTGAGGGGGGGCCACTGTGGAGGGCTGAA
	GCTGACCCTGGCTGCATCTCGGGAGTTTTCTTGTCACGGGTCCATACTGCCAGCAAAGAACCAGTAGCAGATAGGTCTAAGCCTCCCCTCAGAGGCCCGC
	TTCCTTCTGCCAGTGTGGGCACTGGAGAGGTTTTACACTCTATGGGCAGCCAA
Exon3 20140701 - 20139199
	ATGGAGGAAGACAGGCTTCCTGCCTCCCAGGACCTACTTCCAGCTCTTCAAGTCTTTGGAACTATAACTGTTTGCTCAGGACAGGAGGCTGACAGTGAAG
	ACTTCCAGGCTACGCTTGATCCATCTCAGGTGTTGGGCCTCAGCCAGCAACCACACACCTCAGGTCTCCCTCTCCCGCCACAGTGGAAGTCCACGGTGAG
	CCCAGGTGCTCCTCAGCTTTCTAGCAGAAGCATCTCTGCCTCCTCGGTGGGCAGCAGTCTTCAGGATCACCAAGAGAAGGCAGGACCTCAGAGGGCCTCT
	TTTGCCAATGTCTCCTCTCCCGAGTTGACTGTACCCCAGGCAGCCCACTCTGTGGTGGGGGCAGGGCCTCCGCTCCAGGGGTCAGCACAGCCTCTGACCT
	CTGGCAGTGATGCTACAGGCCTGGGTAAGAGACACCTCTCCTTTCAGGCAGAATACTGGGCCTGTGCGCTGCCAAATTCTCTGCCTCCTTCCCCTAACCG
	CCACTCCGCACTCTGGGACCCAAATAAAGAGTATGAAGATCTGCTTGACTACACTTACCCACTGAGGCCTGGGCCTCAGCTCCCAAAGCAACCTGAAAGT
	CATGTCCTGACTGAGCCTGTTCTGCAGGACTCAGGTGTAGATCTGGACAGTTTGTCTGTCTCCCCAGCAAGTACTCTAAAGTCACCCACTAATGTCTCCC
	ACAATTGCTCATCAGCAGAAGTGCCTACTCTGCCATTTTCTGGAGCCAGAGAGTCATGTCTTAAGCGCTGGCCCTTGGGAATATTCCAGAAACAGGGTGG
	CACAAGCTTGTCATCCTGGAACCAGCTTGCATCAACCCCTAGAGCCCCAGGCACTGAAGATGCTTCTTGGGAGAACAGAGAGGCAGCCCTGAGGGGCACA
	GCGGAGGACTGCCTCCCTATAGGTGAGGACCTCCGAATGGGCTCTCCCCAGCTGAAGACGAAGGAGAAAGAGCCACCCTTTCCCAGACAGAAGAGAGGCA
	GGCAGCATGTTAGCTGCCCGGCCTGTGTGACGCCTGGATGGCCATCAGAAGAGGAGGTGGGAAGTGATGAGGAGTACCTTGCTCTGCCCACCAGGCTGAC
	TCAGGTCTCTAGTTTGGTGTCCTACTCAGGTGCCAGGCCCTCCTTTGTGAACCTACACACTGGGGCTGCTGAGGAACACAGTTCACTACAAGTCTCAGAC
	AGTGACAAGCCAGCCTCCCCCACATTGGACTCCAGCCACAGGAAGCATCCTTCTGGAACTTCCTTTCAAGGGCCTGTGGGCCAGAACCCCTGCTTCAGGC
	ATTCTATCCAGCCCCAGGACTCTAGAGGCAAAAGTAGTCTGATGAGTAACCAGACCCTCGGGGTCTCTTCAAAACCACTGAAAACTCAGCCCGCCTCAAA
	AGCCATGACGGACAGGCGGCTGTTCTCCGAGCTAGTAGCTGGAGAGACACTTCCCAGGACGACAGATGAGCAGGAGAAAGCTTCTCTAGTGCAGTGTGTG
	CAG
Exon4 20138591 - 20138469
	ACATTTTGCTGTCGGCTGGAAGAGCTGATCTGCTGGTTGTATAATGTCACAGATGTTGCTGACCTCAGTGCTCCACCCAGGACCAGCCTTACAGGTCTCA
	AGTCTTCTCTGCAGCTTTACAGG
Exon5 20136105 - 20136009
	CAATTTAAGAAAGATGTAGACGAACATCAGTCCCTGACAGAGAGCGTCTTGGAGAAGGGAGAGATTCTTCTTCAGTGCCTGTTGGATAACACCCCAG
Exon6 20130597 - 20130427
	TTTTAAAGGATGTCCTTGAGAGGATTGCAAAGCAGTCTGGTGAGCTGGAGAGCCGTGCAGATCATCTTTATGACTCTATCTTAGCCTCTTTGGACATGTT
	GGCTGGCTGCACCCTCATCCCTGACAACAGGCCAACAGCAGCAGAACACCCACATGAAGGGCTTTAACACA
Exon7 20129484 - 20126692
	GCAGAGGTGGAGTCATTGGCGAGATGGCAGCTGGAAAGAAAACTCAAGAACTCCTTGTAAGAGCCATGGAAGTTAAGGAAGGGGAGGAAATCAACTTGAA
	CACACGTTAAGATGCCTTTCTCGCCTCTGAAGGATCCTGAGTCACTGCCCTCATTTACTATGAATCCCTCCAAAATTAAGGCCGTTTCTATGGTGCTTCT
	CTACAATAATTATGTGGCTTTATAATTAGTTGATAAAATATTAAGACTTGTGGGTCTCGTGTTTAAAAACCAGCAGATAAAATGTGTTGAGGCCATTTAC
	AGAAAGCTGCTGGAGAAAGGTTCTACGTACTTAGGATTCTCAGGCATACAGGGGGATGGGATCTAAGAGAGAAAATGTTAGTGGCCAAAACTGTAGAGTG
	AAATGCTCACCCTTAGTAAGTCGGGAGAACCTCTACAGAGTCCTAGGAGTTGCCACCTATAGTGGTCAGTCTCCACTTCAACCATGTCAAGAATGCTCAG
	GAGCTGGCCTGCCATGCTTCTGAACTGCATGCTTGTGCTAACCTCTGGGGATCTCAGGCCACAGTTCTCTTCCCCTTGGAAGACTAGTCAGAGGACTGGG
	CCGGGTAGAGACAGCCACATGGTCTGTGCGTACGTAAATTAAAGCAGCCATTGGTGATGAAAAGCGGGGAGTCTTTGTAGTTTGGGAGTGAACAGGAAGT
	TGTGCCTTGTCAGGAAGAAAAGAATTCTATGGACCTATCATAGGTCCATATGTTCAAAGCATCAGTTACAGCTTTCCAAGCAAAGTGTTTGTATGTTGGC
	TACCACAAATTCCACAAAGTATCAAAGGTGGGCTTTTCAGGTTTAAAAAAAAAATAGCTATTTAGATAAGCATgtacatgactttaatcctagtacttaa
	aagtagctctgtgagtttgaggacagtctggcttgtttattagagtccaggctgccagggctttataaagaagaagaagaagaagaaggaaaaaaagaTT
	CTTCAGTAAGTATGCATAAAATACAGTATTTTTACATGCCTGATGCTACACAGCATGATTTACCATAATGCTTATGGGCATGATCCATATTAAGAGTTTT
	GTTGTTACTGGTTTGTttttgggtttttgagacaaggtttctctgtgtaacagaaccctggctgtaccgggactccctctgtagactaggctggcctcaa
	actcaagagagatcctgtgcctccccaagtgttgggattaaagtcatgcaccagctcacattagttttattctgccatctctaagttaaacttatttctt
	atactgtacatggtaCATAAAGTGCTTTCAAGAGGCTAAAACAAAACTTTTCTAGCAAATAATTTAAGTTAAATGTAAAATATCCTATAAAACCTAGAAT
	TGGTCAAAAGCACATCTTACCTCTCATGTGGATTTAAACTGCCTTCCCACCAATATGTTAAAGGAGCCCTCAGGTATTAAAGCCATTTGTCAAGCATGAA
	AGTCAGGAGACTCATAGAGCTAGCCAGCTGCTCCAACTGAATGCAAAATGGGGCACTCCTCTTCTTTTGCTGTATAATTACAATTGATTCAACTGACAGT
	GAGCATGGTTTCCCAACACAATACTGGCCCGAACATGCTCTATGCTTCTGCTCATCCTCTTTGTAACAAGAAGATAGACTTTTTGTAACTAAAGGGTGTA
	ACTCTGACCTTGGCTGTGAATGCCATTTAGGAATATCAATACAACTGTTGTTTTATCTTCTGGTGTGTGTTATGTTTGAGCTAAAATGTCTCAGCCTTGG
	ATGTCACTACCATTTGCATCTGTAAATGTGGCCAGGCTAGACTCAAATAGCCTTTTTAGAATTTATAAATGGTCCCTTAAAGTTCAGAGTTCACAGTAAA
	GTAGCATCTTGAGACAGGGTTGTTACAGGTCTACAGTGAAGCTCTAGCACAAAACAAGATAATTCAAACAGCTTTGAAACTTAAAATGACATCGTGGTAC
	AAGATGTGGCCAAATATGAGCCTGAGGGAACTGTCCGAAAGAGCACTGGACCTTAGGGGAGCCGTGGCCAACTGAGAGAGTGCTTTTCATTATGCACGTT
	TCTCTATGGCAGTCATTTTTAAAATATATCAAGGGACAGTTTTCTATTATGTGAACATATTAGAGCCCCCAAGAGTCTTGAAATATTTATACTTGAAAAA
	TGGGTTATTTCCCACTCTAAAACAGCAATTATCAGCACATACATGAAACCAAATAGTGAAGCATGCTGAAATAGTCTGGTAAGCCCTAATCTTGCTGCCA
	GTGGGGAAAGAGCACTAGAATTTTAGTCTGTAAATATGTTTATATTAAAAATAAATTCATGTAATGTTTTCTGCTAACAGAATAAGCTGACAGTTTGAAC
	AACTTTTGCTGTGTAAAATTAAAGTGCTTGGCACCATTTCATCCTATATTGGTGTTGTATCATTTAGTTATGATAGAAAACAGTTTATGAACTCTTTCTC
	CCTTTATATTGACAAAAAACCAACAGCTACAAAAAAATAAAAGATATTGACCCAATTCCTGGTGACTTGAGGAGTTTCCAGTTACCTTTTTATATATAAG
	GATGAATAGACCCAACAAGCGCATCTATAATACAAAGTAAACTATGATTTTATTGTGAAATTCTCATAGATGGAAAATTAAATTGAATATTTATTCTGTC
	CATTTTTCAATTTACAATAATCTTACCACTTATTTTTGTACCATGTATTTCAATTGTCTGTTTAGTGAAAAATAAACCTGTAATTTCTGGCTT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+54dbEST_BU516730.1,dbEST_BQ920118.1,dbEST_BU614485.1,dbEST_BI656308.1,REF_NM_172260.3,GB_AK140820.1,GB_AK031622.1,GB_BC027174.1,GB_AK172975.1,GB_AK146669.1,GB_AK169934.1,GB_AK162594.1,GB_AK205251.1,GB_AK172304.1,
23+45dbEST_BU516730.1,dbEST_CN533978.1,dbEST_BI148503.1,dbEST_CN697737.1,REF_NM_172260.3,GB_AK140820.1,GB_AK031622.1,GB_BC027174.1,GB_AK172975.1,GB_AK146669.1,GB_AK145286.1,GB_AK169934.1,GB_AK162594.1,GB_AK205251.1,
34+29dbEST_BE532885.1,dbEST_AI449902.1,dbEST_AI464182.1,dbEST_BM899220.1,REF_NM_172260.3,GB_AK148267.1,GB_AK140820.1,GB_AK031622.1,GB_BC027174.1,GB_AK145286.1,GB_AK169934.1,
45+10dbEST_CO432688.1,dbEST_BB482727.2,dbEST_CX732508.1,dbEST_AA734373.1,REF_NM_172260.3,GB_AK148267.1,GB_AK140820.1,GB_AK031622.1,
56+18dbEST_BF159265.1,dbEST_CO432688.1,dbEST_BU694389.1,dbEST_CF554147.1,REF_NM_172260.3,GB_AK148267.1,GB_AK140820.1,GB_AK031622.1,
67+23dbEST_BI557849.1,dbEST_CF532957.1,dbEST_CF736611.1,dbEST_BF159265.1,REF_NM_172260.3,GB_AK148267.1,GB_AK140820.1,GB_AK031622.1,