NIA Mouse Gene Index (mm92)

Exon structure for U033164

chr11 -

Exon1 80593527 - 80593200
	AGAGGCGGGACCAGCCGCCGCCGTCTCCGTCTCGCCACCACGGCCCCCACACAACCCGCAGCCACCGCGGGAGGAGCGGAAGCCGCCGGCCTCGCCCGTT
	CAGAGCCGCGCCGGCTGGAGCTCTGAGGAGTGGCGGCCGtctctctcgctctctctctctctcCGGCCCGACCCCGCCCAAAGGTGCCGAGCACCCCCGC
	CCCAACCCGAGCGCTCCCACCTGAGCCGGCGCCATGGCGGAGCAGGAGAGCCTTGAGTTCGGCAAGGCGGACTTCGTGCTGATGGACACCGTCTCCATGC
	CCGAGTTCATGGCCAACCTTAGGCTCAG
Exon2 80506591 - 80506383
	ATTTGAGAAAGGACGCATCTACACATTCATCGGAGAAGTGGTTGTTTCTGTGAATCCATACAAGGTGCTGAACATCTATGGGAGGGACACTGTCGAGCAG
	TATAAAGGTCGTGAGCTTTATGAGAGACCTCCTCATCTCTTTGCTATTGCTGACGCTGCTTACAAGGCCATGAAGAGGCGATCAAAAGACACCTGTATTA
	TGATATCAG
Exon3 80499445 - 80499352
	GGGAAAGTGGAGCTGGTAAAACAGAGGCCAGTAAGTACATCATGCAGTATATCGCCGCCATCACCAACCCCAGCCAGAGAGCAGAGATAGAAAG
Exon4 80497992 - 80497827
	AGTGAAGAATATGTTGCTGAAGTCAAACTGCGTTTTGGAAGCTTTTGGAAATGCCAAAACCAATCGTAATGACAATTCCAGCAGGTTTGGGAAATACATG
	GATATCAACTTTGACTTCAAGGGAGACCCCATTGGGGGACATATTAATAACTACTTGCTGGAAAAG
Exon5 80495937 - 80495884
	TCTCGTGTGATTGTGCAGCAGCCTGGAGAACGGAGCTTCCATTCTTTCTATCAG
Exon6 80493617 - 80493522
	CTCCTCCAGGGAGGTTCTGAGCAGATGCTGCACTCTCTTCACCTGCAGAAGTCACTCTCATCCTACAACTACATCCGTGTGGGGGCACAGCTGAAG
Exon7 80490440 - 80490324
	TCTTCCATCAATGACGCTGCTGAGTTCAAAGTTGTAGCTGATGCCATGAAAGTAATTGGATTCAAACCTGAGGAGATTCAAACTGTGTATAAAATTTTGG
	CTGTTATTCTTCACTTG
Exon8 80489756 - 80489553
	GGAAATTTAAAATTTATAGTAGATGGTGACACGCCGCTTATTGAGAATGGCAAGGTTGTGTCTGTCATAGCAGAATTGCTGTCTACTAAGGCAGACATGG
	TGGAGAAAGCCCTGCTTTACCGGACGGTGGCCACAGGCCGTGACATCATCGACAAACAGCACACGGAACAGGAGGCCAGCTACGGCAGAGACGCCTTTGC
	CAAG
Exon9 80488464 - 80488319
	GCAATATATGAGCGCCTCTTTTGTTGGATTGTTACTCGCATCAATGACATCATCGAGGTCAAGAACTATGACACCACGATACATGGGAAAAACACGGTTA
	TTGGTGTCTTGGATATCTATGGCTTTGAAATCTTTGACAACAACAG
Exon10 80488230 - 80488116
	CTTTGAGCAGTTCTGCATTAACTACTGCAACGAGAAACTGCAGCAGCTCTTCATTCAGCTGGTGCTGAAGCAGGAGCAAGAGGAGTACCAGCGGGAGGGC
	ATCCCTTGGAAACAC
Exon11 80484521 - 80484351
	ATTGATTACTTCAACAACCAGATCATTGTGGACCTCGTGGAGCAGCAGCACAAAGGCATCATTGCAATCCTGGATGACGCGTGTATGAATGTTGGCAAAG
	TCACTGACGGAATGTTCCTTGAGGCCCTTAACAGTAAATTGGGCAAACATGGTCATTTTTCCAGCCGAAAG
Exon12 80480147 - 80480077
	ACCTGTGCCTCAGACAAAATCCTGGAGTTTGATCGGGACTTTCGAATCCGTCATTATGCGGGTGACGTGGT
Exon13 80476617 - 80476543
	CTATTCTGCCATCGGTTTTATCGACAAAAATAAAGATACTTTATTTCAAGATTTCAAGCGCCTTATGTATAACAG
Exon14 80471027 - 80470895
	CTCAAATCCTGTGCTGAAGAATATGTGGCCCGAAGGCAAGCTCAGCATTACAGAGGTGACCAAGAGGCCTCTGACCGCTGCCACCTTGTTTAAGAATTCT
	ATGATTGCTTTAGTAGACAACCTTGCTTCAAAG
Exon15 80453887 - 80453721
	GAGCCGTACTATGTGCGTTGCATCAAACCCAATGACAAGAAGTCCCCACAGATATTTGACGATGAGCGCTGCCGCCATCAGGTAGAATACCTGGGGCTGC
	TGGAGAATGTGAGAGTGCGCCGGGCAGGGTTTGCCTTCCGCCAGACCTACGAGAAGTTTCTTCACAG
Exon16 80451583 - 80451376
	GTACAAGATGATCTCTGAGTTCACCTGGCCTAACCATGACCTTCCTTCAGACAAAGAGGCTGTCAAGAAACTCATAGAGCGATGTGGCTTTCAGGATGAC
	GTAGCTTATGGGAAGAGCAAAATTTTCATTCGAACACCCCGTACACTGTTCACCCTGGAAGAACTTCGTGCCCAGATGCTCGTCAGGGTTGTCCTCTTCC
	TACAAAAG
Exon17 80415308 - 80415085
	GTGTGGCGTGGCACCCTGGCCCGCATGCGGTACAAGAGGACCAAGGCAGCTCTGACAATAATCAGGTACTACAGGCGCTATAAAGTGAAGTCGTACATCC
	ACGAGGTGGCCAGACGATTCCACGGTGTCAAGAACATGAGGGACTATGGGAAGCATGTGAAGTGGCCAACCCCACCAAAAGTCCTGCGGCGTTTCGAGGA
	GGCCCTGCAGTCGATTTTTAATAG
Exon18 80407385 - 80407241
	ATGGAGAGCATCCCAACTCATCAAGACCATACCTGCATCAGACCTTCCCCAGGTCAGGGCAAAGGTTGCAGCCATGGAGATGCTGAAAGGTCAAAGGGCA
	GACCTTGGACTCCAGAGAGCCTGGGAAGGCAACTATCTTGCTTCG
Exon19 80406393 - 80406289
	AAGCCAGACACACCTCAGACCTCAGGCACTTTCGTCCCAGTTGCTAATGAGCTGAAACGCAAGGACAAGTATATGAACGTTCTCTTTTCCTGTCACGTCC
	GGAAG
Exon20 80400462 - 80400349
	GTGAATCGGTTTAGTAAGGTAGAAGACCGAGCAATTTTTGTCACTGACCGTCACCTGTATAAAATGGACCCCACTAAGCAGTACAAGGTGATGAAGACTA
	TCCCACTGTACAAC
Exon21 80397492 - 80397327
	ATCAGCCATGCACACTCGTCAGCCCTCACCTTGCATCTACTTCTGGGAAGAACTAACTTCAGAACAATGGAATGGCTGCCTCCTCTAGTGAGGCAAACTG
	GGTACAAAGGGGGCCTCCAAATGTAGCCTGAAGGGGTTTTTAATCTTGAAGTAAATATGGCAATAT
Exon22 80371090 - 80370936
	TTGACTGGTCTGAGTGTCTCCAATGGAAAGGACCAACTTGTAGTGTTCCATACAAAAGACAACAAAGACCTCATTGTCTGCCTCTTCAGCAAACAGCCAA
	CCCATGAGAGTCGTATTGGAGAACTTGTTGGAGTCCTGGTGAATCATTTCAAGAG
Exon23a 80297884 - 80296199
	TGAGAAGCGCCACCTTCAAGTGAACGTCACCAACCCGGTGCAGTGCAGCCTGCACGGGAAGAAATGCACCGTCTCTGTGGAGACCCGGCTCAATCAGCCA
	CAGCCTGACTTCACCAAGAACCGCTCGGGCTTCATCCTCAGTGTGCCCGGGAACTGACTGCTGCACATCAGAGGCCTGGCCCAGGGGAGCAAGAGCCTGA
	GCCTGGCACAAAAGGCAGGCAGGCCCTCACTCGTCCTCTGCATCCCCACACTCGTTCCACCTCGATCAGCATCCCAGGAGCTCAGCTAATCGCTGTCTGC
	CCTCTAATGCCACTAGAAATCAGCTTGTAAGGGCCTCTGCTAGGCAGGGCTCCTCTGCCTTCTCATGGCCCTGCCCATGAGTTGTCCTACCTGGCTTTCT
	GCCTCTGCCTCTGCCCTCTCAACTTTCCATACCCCCGCTCAGGAAACCAAAGACCCTCTTCAGCCCTCTGGGCTGACAGCTAAACCACTTCCCACCTCAC
	AAGCAACTGGACGGTACCTGTAGTTGGCAAAAGGCCACTGGCCACTGCTGACCTCGGCAAAGGGATGAGAGGCACAGAGCCCAGGATGCAGTTCCTGGAG
	CCCAAAGCCACATTCCTTCCCCTAGAGGTTTGGATGCTGCATCCATGGGCGTAGGACTTAGTCCTCCTCTGTGACCCCCTACCTGATGCCTCCTTCCCCG
	ACATGATTGCAGTCCTTGGGATCTAGCTCCGAGCCCCTCAGCATAAGCCCTACCCCCAGCAGCCAGCCAAAGCCACCAGGTGAGCAGATTCATCTGCAGA
	GCCCACCCCCCAGCCATGCTCAGCCTGGATCCCTCCTTCCCAGAGCCTGTCCCTGGGAGATCTTTCGCCACCAAGGTTCTAACCGCAGACTTTCTAAGCA
	CTTCTCTCAGAGAGACGCCCTGCTGCTACTCCGAGGAGTCGGCTTCACTCACAGCCCATGCCCACAGCCATCGTAACCTGCTTTCTTGCAGATTGCCAGG
	TTACTAATCTGACACCCCCTTTGCTGTAAGCAGTGTCAGGACCTGGTGAGGAGGTGCAAGGAGAAGGCCCTGCTTGGCGTGCCCGTTCCCTTAACCCTCT
	AGCTGCACCTGCCTCCTCCCCACTGGAGACCTGGAACTCTCAGAGAGCCAACGCACGCAGGACCCAGAGGTGGGAGGTAGAACAAAGCTGCAGCAAAGAA
	CGTGGAGTCCTGGCACTGCAGGCCAGGCCAGGGTGCCCACCTATGCCACATACCTGCCTGCTGGAGCCTTGCCTGAGCCCTGCTGGCAAAGTGCAGCATG
	TTTGCCAGTGTCTGCCCAGGAGGGAGCATGCCTGCTTCAGAGGTCTTCCTGAGAGCCCTGCTCCCAGCCTGAGCTGTTGAGGAGGAGGCCTATGCCGGCA
	CAGGCTTGCTGTGGGGAACCCTAACATGGAAGGCTTGTAAGGGGCAGGAGCGAGCCACAGGGCTCTCAGAGCCAGGCTCACATTCTCTTCACTGTTGGCC
	AGTCTCTGCTCCCTCATCCTCACCCTGCCACCCTAACCCACTAAGTGCCTGTGCGCATCCTCCTATGCCTTGCCCGGGGCCTGAGGGAGTCACCTGGCTG
	GCCAGGGTGGGTCCAGCACCTGGTCTCCTACCCCGTTTGCAGAGCTGTGGGGATGTTTACACACAGGAAAGTTTGCAACCAAACTC
Exon23b 80296198 - 80296168
	GGTTGCCGTGCTGCCCTCCGGAACCGTTCTC
Exon23c 80296167 - 80295621
	ATTCTCCAAGCCTGGTCAGCTGCCCCTGCAGTGGCTGCTGTGCCGCCAGCCAGGTTTTGCGGATCGATCGCTGGTGGACCTGACAGAACCATGTGACTGG
	GACCTCACCTTCCCACCCCATCACTGCCCCAGCATATTGCTTTACACTAGACATGCTCAAGTGTGTTCATGCACACCAGAGCAGGTCATGCCAAAAGAGT
	TGCAGGTCAGTGGGTGGGGTTCTCCTCCCACCCTCTGATGTCGTCTGGGACCTCTGACCCAGGCCAGAACCTCCCACTGAGGACTGCCCTGTCCATACGC
	ACTTTCTTATGACCTAGAAGTCAGTGTGTGGCCACTGAGGGACCTGGAATTCGGGGTGTGACTGACCACAGTAACAGCAGAGGAGAGGACACAGTGATTG
	TATGCATGGAGTAGGGGTCTCTTGAGTTAATGAAATGCAGTTTATGGTTTGGTGCATATATTCCTATTTTCCATTAAATTAACTTTATTTCTAAAGCATA
	TTTTGATTTACCATCAAGAGCAATAAAGCATTAAATCTTATTTTAAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+14dbEST_BI662310.1,dbEST_BB630128.1,dbEST_AW227000.1,dbEST_BB854810.1,REF_NM_177390.3,GB_AK049374.1,GB_BC150765.1,GB_AK037051.1,GB_AK188302.1,GB_AK203977.1,
23+11dbEST_BI662310.1,dbEST_BB630128.1,ENSMUST00000041065,ENSMUST00000070997,REF_NM_177390.3,GB_AK049374.1,GB_BC150765.1,GB_AK037051.1,GB_AK188302.1,GB_AK203977.1,
34+9dbEST_BI662310.1,dbEST_BB630128.1,ENSMUST00000041065,ENSMUST00000070997,REF_NM_177390.3,GB_AK049374.1,GB_BC150765.1,GB_AK037051.1,
45+8dbEST_BI662310.1,ENSMUST00000041065,ENSMUST00000070997,ENSMUST00000125944,REF_NM_177390.3,GB_AK049374.1,GB_BC150765.1,GB_AK037051.1,
56+8dbEST_BI662310.1,ENSMUST00000041065,ENSMUST00000070997,ENSMUST00000125944,REF_NM_177390.3,GB_AK049374.1,GB_BC150765.1,GB_AK037051.1,
67+10dbEST_BF016443.1,ENSMUST00000041065,ENSMUST00000070997,ENSMUST00000125944,REF_NM_177390.3,GB_BC039700.1,GB_AK049374.1,GB_BC150765.1,GB_AK037051.1,GB_AF426464.1,
78+11dbEST_CB519346.1,dbEST_BF016443.1,ENSMUST00000041065,ENSMUST00000070997,REF_NM_177390.3,GB_BC039700.1,GB_AK049374.1,GB_BC150765.1,GB_AK037051.1,GB_AF426464.1,
89+12dbEST_CB519346.1,dbEST_CK634920.1,dbEST_CB722839.1,dbEST_BF016443.1,REF_NM_177390.3,GB_BC039700.1,GB_AK049374.1,GB_BC150765.1,GB_AK037051.1,
910+13dbEST_CB247052.1,dbEST_CN457044.1,dbEST_CB519346.1,dbEST_CK634920.1,REF_NM_177390.3,GB_BC039700.1,GB_AK049374.1,GB_BC150765.1,GB_AK037051.1,
1011+12dbEST_CB247052.1,dbEST_CN457044.1,dbEST_AI957149.1,dbEST_CB519346.1,REF_NM_177390.3,GB_BC039700.1,GB_AK049374.1,GB_BC150765.1,
1112+11dbEST_CB247052.1,dbEST_CN457044.1,dbEST_AI957149.1,dbEST_CB519346.1,REF_NM_177390.3,GB_BC039700.1,GB_AK049374.1,GB_BC150765.1,
1213+9dbEST_CB247052.1,dbEST_CN457044.1,dbEST_CB519346.1,ENSMUST00000041065,REF_NM_177390.3,GB_BC039700.1,GB_AK049374.1,GB_BC150765.1,
1314+11dbEST_BE571075.1,dbEST_BI646136.1,dbEST_CB247052.1,dbEST_BY152566.1,REF_NM_177390.3,GB_BC039700.1,GB_AK049374.1,GB_BC150765.1,
1415+14dbEST_BE571075.1,dbEST_BI646136.1,dbEST_BB854980.1,dbEST_CB247052.1,REF_NM_177390.3,GB_BC039700.1,GB_AK148112.1,GB_AK049374.1,GB_BC150765.1,GB_AK204533.1,
1516+14dbEST_AW229076.1,dbEST_BF584413.1,dbEST_BB770900.1,dbEST_BE571075.1,REF_NM_177390.3,GB_BC034071.1,GB_BC039700.1,GB_AK148112.1,GB_AK049374.1,GB_BC150765.1,
1617+12dbEST_BF584413.1,dbEST_BB740859.1,dbEST_BB770900.1,ENSMUST00000041065,REF_NM_177390.3,GB_BC034071.1,GB_BC039700.1,GB_AK148112.1,GB_AK049374.1,GB_BC150765.1,GB_AK190949.1,
1718+11dbEST_BF584413.1,dbEST_BB740859.1,dbEST_BB770900.1,ENSMUST00000041065,REF_NM_177390.3,GB_BC034071.1,GB_BC039700.1,GB_AK148112.1,GB_AK049374.1,GB_BC150765.1,
1819+9dbEST_BB404816.2,ENSMUST00000041065,ENSMUST00000070997,REF_NM_177390.3,GB_BC034071.1,GB_BC039700.1,GB_AK148112.1,GB_AK049374.1,GB_BC150765.1,
1920+9dbEST_BB404816.2,ENSMUST00000041065,ENSMUST00000070997,REF_NM_177390.3,GB_BC034071.1,GB_BC039700.1,GB_AK148112.1,GB_AK049374.1,GB_BC150765.1,
2021+4dbEST_BB404816.2,ENSMUST00000070997,GB_AK049374.1,GB_BC150765.1,
2022+7dbEST_BI157529.1,dbEST_BG917685.1,ENSMUST00000041065,REF_NM_177390.3,GB_BC034071.1,GB_BC039700.1,GB_AK148112.1,
2223a+9dbEST_BF580965.1,dbEST_BI157529.1,dbEST_CB946831.1,dbEST_BG917685.1,REF_NM_177390.3,GB_BC034071.1,GB_BC039700.1,GB_AK148112.1,
23a23c-1GB_BC039700.1,