NIA Mouse Gene Index (mm92)

Exon structure for U033189

chr11 -

Exon1a 83112790 - 83112758
	TGGTAGGCAAGAATGAATCTTTTGTCATTTTAG
Exon1b 83112757 - 83112480
	TAAAACTTGCTGATAACTGACTAACACTCGGGAAGGTGGCCGACTTTGAGCTAAGCACCACCTGGCAGAAAGGACCTGGCTTGATCTCCCATGGCAACCG
	GCGTCAGGCAGGGACCCCAGCTCGGCACAGAGGCTCGAGTACCGCCCTCCAGGAAGCTTCGCTCAGAGCTAACCAGGAACAGAATGCACTCACTGCACTA
	ACCCGTCGCCTCGTCGTCAGGGGGGCGGAAACGGAAGTCCCAGTTGGTCATAGAGTTCCCGAGTTCCGGCTCAGGGCT
Exon1c 83112479 - 83112414
	ACATTCGATGCTAGAGCGCCTGTCTTCCGCCCGCCGTGTGGAGGTCCTCGGAGCTTCTGTTTCCGG
Exon1d 83112413 - 83112342
	GTACGGTTTCGGTCACAAAGCCGAGACCTCCTTTCGCAGGTGGCGTCACGGGTCCTCTGCTCCGTGCCCGAG
Exon1e 83112341 - 83112214
	GTCAGCAAGCAAGGACGGGCGCTTCTCAGGCAGCCGCCGGAGCCGGGCCTCGCAGCTCCCGGACTGCGGTTCGAGCGACACGTTTCTTGGCCCACTCCCC
	GCCTCCGAGTCACGCTCTGCCCTGTGAG
Exon2 83112055 - 83111818
	TTTCAGGTGCCATGCAGAAGGACTAAGACTCAGCACCCGTTTGATACAAAAACAAGTTCATGCTCACTAGAGTGTTCGTGGGAAAAGTGAATCCCAGTTC
	ACACAAGACACAATGGCTGAGTATGGGGCTCACATCACAACTGCTTCAGTGGCGGACGACCAGCCATCCATCTTTGAGGTGGTAGCACAGGACAGTTTAA
	TGACAGCAGTGAGACCCGCTCTTCAGCATGTGGTCAAG
Exon3a 83111709 - 83111544
	GACTTAATGGGCATCCATTCAAAGAGCTCTGTACTCCATTCCTATGACCTCAGGAACTCAGACTATACCCCAAAAGCCAATTACTTAAGCCAGGTGTATT
	GAATTTAAAAGGAAAAGGCTGATGTGAATACAAACTGAAGACTGTAATAAAATGTTTTTGCATCAG
Exon3b 83111543 - 83110990
	GTTCTTGCAGAATCAAATCCTGCGCACTATGGCTTCCTCTGGCGGTGGTTTGATGAAATCTTCACTCTGCTAGACTTCCTGCTCCAGCAGCATTATCTTT
	CTAGAACTAGTGCCTCATTTTCTGAACACTTTTATGGCTTAAAGCGGATTGTGGCAGGGAGCTCGCCGCATCTTCAGAGACCGGCCAGTGCTGGTCTTCC
	CAAGGAACACCTCTGGAAATCTGCCATGTTCCTTGTCCTTCTTCCCTATCTGAAAGTGAAGCTAGAGAAGCTGGCTTCTAGCTTGAGAGAAGAAGACGAA
	TACTCTATTCACCCCCCTTCTTCTCGCTGGAAACGATTCTACAGAGCCTTTCTGGCGGCCTACCCTTTTGTTAACATGGCCTGGGAAGGCTGGTTTCTTA
	CACAACAACTGCGTTACATCTTGGGGAAAGCTGAGCATCACTCTCCCCTGCTGAAACTGGCTGGAGTTCGGTTAGCTCGACTGACAGCTCAGGACATGCA
	AGCTATCAAACAGAGACTGGTTGAAGCCAGTGCAATGCAGGAGCCCGTCAGAAG
Exon4 83109942 - 83108147
	CGTTGGTGAGAAGATAAAGTCAGCTCTGAAGAAAGCTGTGGGAGGTGTTGCCTTATCCCTCTCGACTGGCCTCTCTGTGGGTGTATTCTTCCTGCAGTTT
	CTTGACTGGTGGTACTCTTCTGAGAACCAAGAAGCCATCAAATCACTGACTGCCCTGCCCACTCCACCACCACCTGTACACCTAGACTACAACTCTGATT
	CTCCCCTCTTACCCAAAATGAAAACAGTGTGCCCACTCTGTCGTAAAACTCGAGTGAATGATACGGTTCTTGCCACCTCTGGCTATGTATTCTGTTACCG
	CTGTGTGTTTAATTATGTGAGGAGTCACCAAGCCTGTCCCATTACAGGGTATCCAACAGAAGTCCAGCATCTAATTAAACTCTACTCTCCAGAGAACTGA
	
	TACATTAACTTTAAGTAGTTACATGGGTTTCTTTAAAAGGATATATCCATTCGATCCTAACCTTTTGGTTTGCTCTCTACCAAGCTGGTTAAGCAGGAGA
	ATCAGGATTATCGGTGGTGTGAGAGCCAATGTGGAGGTGAGTTATAAAAGACCACCTCACTTAAAGAGTAAGGTTTTAagttggatgtggtagtatagta
	tcaacactctggagatggaggcaggattttgagttcaaggccaccataggGAGACTGTCAAAAGTAAAATGAAAGTGAGAGACTGATTAAGAGGGATAAA
	ATATCACAGGAAACCTCAGGTTAGACCTTATAAAGCAAGTGGTTTGGGAAGCAGGCCTTCTCTTTAGAAAACATTACTTTTGAATTAGAGGCTTTATCAG
	ACATGGACTTTCTCTTTATAGAAATGCTTTAGAGAAAAGCCCCTTCCATCTATCATGACTTACTAACATCTACCACAGTTTATCAGCATTTGAAGATTTC
	CTTGATGATCCATACTTGTCTTGGGATAGGGTTTGTTTATAGGGAGGAGTCTGGAAATTTCAGTATGAATGAAAACTAGCAGGCAATGGTGAGATGCAGT
	AAAATCCTTATCTAATGTTTACCTGATGCCTACCTAGTGAAGAGTTAATGAAGGGCAGAAGCCTTCTGCTTGCTCTCATGAGTTTGCTCAACTGGCAGTT
	TGCTCAGTTGATATGAATCATGCTAGGTATTATGAAAGTTTCTATGAAACATTTAAGTCAATTTTAACAATACATGATTCTGGGAAAGAATTGTTCCATG
	CTGTCATGATTATGCGGAAACCCAAAAGATTACTTCAGGGGTTTAAATAAATTTCCGTTCAGATCACCATTGACTTCTTGAAGTTTTTCTGTATCTATTA
	AAGTTTTGCTTTTTAAAAAGACAAATTCAATAATTAGAACAAAAATCCTGTTCTAACAGCACAGATACCACCTTGTATGAAATAACATTTGCCAGAAACA
	AAAGTTTAGTTGCTTGTTTAGGAAGATTTATGACATTGGATGGACAAGCTGGTGAAGAAACAGCTTCTGAAAAATCATTAATGCAAGCCAGATGAAAATA
	ATTTCCAAGTGCCTACTGTGATTCATGCTGGCAATTGAGCGCATAATCGCTGGTACCATGAACATGATATAACTTTTACTAAGTTTAAAATAGATAAGCC
	ATCTTGTAGATTTAAAAATATTGAAGCTTACCAGAAGAAGAGTATATGATCATTTATAAGCTCTGGTAAAAACTTACCAAAATAAAGATCTTACCC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1c2+1dbEST_CJ047397.1,
1d2+8dbEST_BB628096.1,dbEST_BG088662.2,dbEST_BU698578.1,ENSMUST00000018877,REF_NM_134025.3,GB_AK035552.1,
1e2+34dbEST_BQ959771.1,dbEST_BU517959.1,dbEST_CA492955.1,dbEST_AW475528.1,GB_AK041175.1,
23a+3dbEST_BG088662.2,ENSMUST00000153487,NIA_H3156A09-5,
23b+39dbEST_BQ959771.1,dbEST_BU517959.1,dbEST_DT920374.1,dbEST_CA492955.1,REF_NM_134025.3,GB_AK035552.1,GB_BC021800.1,GB_AK153798.1,GB_AK166413.1,GB_AK041175.1,
3b4+15dbEST_BG861870.1,dbEST_AA033343.1,dbEST_DV656753.1,dbEST_BB224719.2,REF_NM_134025.3,GB_AK035552.1,GB_BC021800.1,GB_AK153798.1,GB_AK166413.1,GB_AK041175.1,