NIA Mouse Gene Index (mm92)

Exon structure for U033684

chr11 -

Exon1a 118280366 - 118280286
	GAGGCGCAGGCGCAGAACAGAGACTGCCGGGAGCGCGCGGCGGGGCGGAAGTGGCCGCCTGCCCTGTCCGGCCCTACGCAG
Exon1b 118280285 - 118280244
	GTAGGCGGCAGCCCGCAGGCTCCGGAGCCAGGCCCTCAGTGG
Exon2a 118279120 - 118279094
	TCCCCTTTACCACGTAATATGCACCAG
Exon2b 118279093 - 118278969
	TGTGTCCAGGAATGCATGACATCCTCTGCCTGCTGAGCAGCGGGGACAGGAGGAGAGGTCTAGAGAGTGGAAGAGGCAGGTGTCCCGTTGCCACCCACCT
	GACTGTGGCATGTGTGCCCATGAAG
Exon2c 118278968 - 118278888
	CTCCCACAGATACGTGCGACCCTGTCACCTGAGCCTTGGAACATCCTTCGCAGTGTGGCTGTCTTCGCCGTGGCCATACAG
Exon3 118277108 - 118277044
	GAGAGACAGGTCATCTTGGCTGTAGTTCCACAGGGTGCTGTACAGACCCAAGGGTGCCCATGGAG
Exon4a 118272825 - 118272605
	GTCCTGTCCAGAGTGCAGTCTGATGCCCATCCAGCCCTTTGACCAGCGGGAATGGAATGAGCCTATGCACTCCCTCCGGATCAGTGTAGGGGGCCTTCCT
	GTGCTGGCATCCATGACCAAGGCCACGGACCCTCGCTTCCGCCCCCGCTGGCGGGTGATCCTCACGTCCTTTGTGGGTGCTGCCCTCCTCTGGCTGCTGT
	ACTCCCACCATCAGGGCCCAG
Exon4b 118272604 - 118272565
	TGCCAGGCAGGCCCCCCACCCACAATGCGCACAATTGGAG
Exon4c 118272564 - 118272167
	GCTCAGCCAGCAGCGCATCTCTCATTACAACGACACCTACCCCCTCTCCCCCCCACAGAGGACTCCAGGTGGGATTCGGTACCGAATCGCAGTCATTGCT
	GACTTGGACACGGGGTCCAGGGCCCAGGAAGAAAACACTTGGTTTAGCTACCTTAAGAAAGGCTACCTGACCCTGTCGGACAGCGGGGACAGGGTCAGCG
	TGGAGTGGGATAAAGACCACGGGGTCCTAGAGTCCCACCTGGCAGAAAAGGGGCGGGGCATGGAGCTCTCAGACCTGATTGTCTTCAATGGGAAACTCTA
	CTCCGTGGATGACCGCACAGGGGTCATCTACCAGATCGAAGGCACCAAAGCAGTGCCCTGGGTGATCCTTTCTGATGGCGATGGAACTGTGGAGAAGG
Exon5 118271504 - 118271394
	GTCAACTGCTGCTACTCAGCCTTGCTCTGAGCCCACCCAGTACAAGGGTCTGTATGCTGAGCAGCAATGACTCCTGGGAACAGAATCTGATATTAGCTTC
	ATGTGTAGCAG
Exon6 118270198 - 118269995
	GTTTCAAAGCTGAATGGCTTGCTGTGAAGGACGAACACCTGTATGTGGGCGGCCTGGGCAAGGAGTGGACCACCACGACAGGGGAGGTGATGAACGAGAA
	CCCTGAGTGGGTGAAGGTGGTAGGCCACAGGGGCAGTGTGGACCACGAGAACTGGGTGTCCAGCTACAACGCCCTGAGAGCAGCCGCCGGGATCCGACCA
	CCAG
Exon7a 118269408 - 118267842
	GCTACCTCATTCACGAGTCCGCCTGCTGGAGCGACACACTGCAGCGCTGGTTCTTCCTGCCTCGTCGGGCTAGCCACGAACGCTACAGCGAGAAGGACGA
	TGAACGCAAGGGCAGCAACCTCCTGCTGAGCGCAGCCCAGGACTTCAGGGACATCTCTGTGAGGCAAGTGGGGACTCTGATCCCCACCCACGGCTTCTCA
	TCCTTCAAATTCATCCCCAACACGGATGACCAGATCATCGTGGCTCTCAAGTCGGAAGAGGACAATGGCAGAATCGCCACCTATGTCATGGCCTTCACGC
	TGGACGGCCGCTTCCTGCTTCCAGAGACCAAGATCGGCACTGTGAAGTACGAAGGAATAGAGTTCATCTAGATGAGTAAGCTCGCACGCCCAGAGGGGCG
	AGGGCCAGCGGCTGTGTTACACCAGGACTCATAAAAACCGGGAGCGCCTCCACTCGTTTGCTTTTTTTCTTTTTTTAACTAAGAGCTGTGTTCCTGGCTA
	GAGAATTTCATTATAGGGAGCTGAGCCCCGGCCCATATGGGTGTACTGCTCGGAGACTGGGAGCAAGGGGTCCTATACAAGGAACCCCAGGTGCTCCGCC
	CACCCGCGCTCACTCTGCACTGCCACTTGGTGGTAGGGATTGATCACTGCTGCAGCTATCTTCTGAGCCTCTGGCCTTCAGAATCCAGCCATGCCTTTCC
	CTGGTCTCTGGCCTTTCCACCACTTCTCTGTCCAGTATGTGTCTTTGAAGCAGCCCCGTGTTAAACCCTAGCTTAACCCTGGGAGCACACAATAGTCTGA
	GGTAGGCCTGCCAGCCAGGCACTggggggggggggggggggcccTCTTTCTCCCATGTGACTCTGGCATTCCATATGCTGCAGACCCCTGGAAAGTGAAT
	GTTTACATGGCAGGGTGAGGGCCACCCCTTGGGAGGCACCTGCCCACACTCTGGAGCCTCTCTAGCACAGGATTGCTTGCGAGCTGTTGATAACTTCATT
	TCTCCCCTCAGGAGGATTTTTGTGCTGTACAGCCTTTTAAAGTCCAAATTATTAACTTATTTTTACTAGAGCAGTTTCTTTTCCTGAATAACAGAGTCAC
	CAGACTTCATCACACAGTGACAGTGGAGTTCCCACATGCACTTCCAGGAGCGAGGGACTTGTCCCCACACCCACAGTGGCGACGTGAGCTTTTACAGAAA
	GAGTCTCAGCATCCCTGGCCTCTGCAACTTCCAAGGGCTGCCATGCTTTCACCCCTCAGCAGTGGTTGAGGGAGGGGCTGCACCTGACTGGAGACCTGCC
	CTCATTGGCTCCTGGTGGGTGTTTAGCAGCCTTCTCTCTAGGGAGGCCTCACTGTTTTCTGCTGTCCTGTTCTGTCCATGTTCAAAAGAGCCAAGGCAGC
	AGAGTCAGGCTCAGAGGTCATTCTGCAGGCAGCAGCACCTCACCTGCCTCCGGCACCCTTAGAACAGGACACCGGTACTGCTGTAGGCACAGGGCCCTGA
	TGACCGTCACAAACCCCTTCCACAGGAAGCCACTGCCACTGGGGCCTGACTACCCTCAGTACAGCAG
Exon7b 118267841 - 118267601
	GCTGCTGCTGACTTGTGGTGCTGAGGTCTTCGTGTACTGTTGTGCTGGGAGCTCAGCCAAACCTCCTTGATGTGTGTCAACTGTGTTCGGTTGTGTGATT
	CTGAGCTGAAAGATGAAATGAGAGAGGTTGAGAGAGACCTGGGCCCCTCGCTGAGGAGCCTTCCACATACCTTCCTTTCCCTGAGCAATGATTGTGTCTT
	TCCATTGTTTTATAAACAATAAAGTGTCAGGGGAATGTGGT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1b2a+7dbEST_BB647411.1,dbEST_CJ161672.1,dbEST_BY316575.1,dbEST_BY345691.1,REF_NM_029502.2,GB_AK081118.1,
1b2b+3dbEST_BY753464.1,dbEST_BY319216.1,dbEST_BY317902.1,
1a2c+11dbEST_BY717823.1,dbEST_BG921741.1,dbEST_BB653100.1,dbEST_CJ148466.1,REF_NM_001025618.1,GB_AK049879.1,GB_AK017942.1,
1b2c+18dbEST_CA320376.1,dbEST_BI219778.1,dbEST_BB658138.1,dbEST_CD562087.1,REF_NM_001025617.1,GB_AK006565.1,
34a+6dbEST_BG963975.1,dbEST_BG866152.1,dbEST_BF582504.1,dbEST_BB581669.1,GB_BC020003.1,
2c4a+54dbEST_CA320376.1,dbEST_BY717823.1,dbEST_BI219778.1,dbEST_BG921741.1,REF_NM_001025617.1,REF_NM_001025618.1,REF_NM_029502.2,GB_AK085059.1,GB_AK081118.1,GB_AK166384.1,GB_AK006565.1,GB_AK049879.1,GB_AK017942.1,
4c5+2ENSMUST00000106289,GB_AK006565.1,
4c6+26dbEST_CF750177.1,dbEST_BQ934449.1,dbEST_BM052556.1,dbEST_BU706272.1,REF_NM_001025617.1,REF_NM_001025618.1,REF_NM_029502.2,GB_AK085059.1,GB_AK081118.1,GB_AK166384.1,GB_BC020003.1,GB_AK049879.1,
56+2ENSMUST00000106289,GB_AK006565.1,
67a+27dbEST_CB056537.1,dbEST_BG868167.1,dbEST_BB427092.2,dbEST_AI552464.1,REF_NM_001025617.1,REF_NM_001025618.1,REF_NM_029502.2,GB_AK085059.1,GB_AK081118.1,GB_AK166384.1,GB_BC020003.1,GB_AK006565.1,GB_AK049879.1,
4b7b+2dbEST_AW543403.2,NIA_C0169E02-3,