NIA Mouse Gene Index (mm92)

Exon structure for U034280

chr12 -

Exon1 103678023 - 103677841
	GGTTTCCTTATACGCCACACTCCGAGGCTGCACAAATCAGGCTGCGCAGGTAGCCCGGGCTCAGCGATCTGTGTTGCCGCAGCTCAATCACAGCGGGGCG
	GACTCTAGAGGTGGCTGCTCTGAGTCTGCGCGACGCCCGGAATTCCCACGGTTCTGCAGTCACCGCGGCGATCACCCGCCCAG
Exon2 103661965 - 103661795
	TCTTCTGTAGCGGACACGGGGTGCAGAATGACCTGGAGAGTGGCTGTGCTTCTCAGCCTGGTGCTGGGTGCTGGTGCCGTTCCCGTCGGTGTGGACGATC
	CCGAGGATGGAGGCAAGCACTGGGTGGTGATTGTGGCGGGCTCCAATGGCTGGTATAATTACCGACACCAG
Exon3 103651772 - 103651675
	GCAGACGCATGCCACGCCTACCAGATCATCCACCGGAACGGGATTCCTGACGAGCAGATCATAGTGATGATGTATGACGACATTGCCAACTCTGAAGA
Exon4 103644087 - 103644006
	AAACCCTACCCCAGGTGTTGTGATCAACCGACCTAACGGCACAGATGTATACAAGGGAGTCCTGAAGGACTACACCGGAGAG
Exon5 103642555 - 103642470
	GATGTGACTCCAGAGAATTTCCTCGCCGTGCTGAGAGGTGACGCAGAAGCTGTGAAGGGCAAAGGGTCTGGAAAAGTCTTGAAGAG
Exon6 103641712 - 103641637
	TGGCCCCCGAGATCATGTCTTCATTTACTTCACCGACCACGGAGCCACCGGGATCCTGGTGTTTCCTAATGATGAT
Exon7 103640942 - 103640880
	CTTCATGTCAAGGACCTGAATAAGACTATTCGCTACATGTATGAACACAAAATGTACCAGAAG
Exon8 103640161 - 103640095
	ATGGTGTTCTACATTGAAGCTTGTGAGTCTGGCTCCATGATGAACCACCTGCCCGACGACATCAACG
Exon9 103638466 - 103638348
	TTTATGCAACTACTGCGGCCAACCCCAAGGAGTCATCTTATGCCTGCTACTACGACGAGGAGAGGGGCACTTACCTGGGTGACTGGTACAGCGTCAACTG
	GATGGAAGACTCCGATGTG
Exon10 103638204 - 103638115
	GAGGACCTGACCAAAGAGACCCTTCACAAGCAGTACCACCTGGTCAAGTCCCACACCAACACCAGCCATGTCATGCAATATGGGAACAAA
Exon11 103636593 - 103636393
	TCTATCTCTACCATGAAAGTGATGCAGTTTCAGGGAATGAAGCACAGAGCCAGTTCCCCCATCTCCCTGCCTCCGGTCACACACCTTGACCTCACCCCCA
	GCCCTGACGTGCCCCTGACCATCTTGAAGAGGAAGCTGCTGAGAACCAACGACGTGAAGGAATCCCAGAATCTCATTGGGCAGATCCAGCAATTTCTGGA
	T
Exon12 103634024 - 103633854
	GCCAGGCACGTCATTGAGAAGTCTGTGCACAAGATCGTTTCCCTGCTGGCGGGATTTGGGGAAACTGCTGAGAGACATCTGTCAGAGAGGACCATGCTCA
	CAGCACATGACTGCTACCAGGAGGCTGTAACCCACTTCCGCACACACTGCTTTAACTGGCACTCTGTCACG
Exon13 103633119 - 103633052
	TACGAGCATGCCTTGCGGTACTTGTATGTGCTGGCCAATCTCTGTGAGGCACCATATCCGATTGACAG
Exon14 103632822 - 103632292
	GATAGAGATGGCCATGGACAAAGTGTGTCTTAGTCACTACTGAACAGCTCGCTTCCCAATGAGTGAGCACAGTCCACTGGAATATGAACCAACCAGAGAC
	TGAAAGGGCGGAGCCAGAGGCAGCACCCGCGCCCCTGGCCCCCAGGAATACTGCCCGCCCACCCCAGGGCTTGCTTTTTGAAGATACCTGCTTACTAAGA
	AGCCAGTTTGGGTGGGTAAAGCTCTCTGGAAGAAGGAACTTTGCTTCTTAGGAGTTTTTTTGTTTGTTTGTTTTGGTTTGTTTTGTTGTCCATTAGCTTT
	CAAGAGCAAATTCCCCGCGGCTTCTCTAGCCAGGGAAGGAATCGTCTGAGAAATTCAAAGCTGAAACCTCTTGCCGTCTTCACAGTGATTTCACTGAAGA
	AGAGGGTGGAAAGCAAGCCCCTATGGGAGAATTATTTTTAGAATTATATAATTTTTGATTGCTTTTATATTTTATTCTGTAATAATGGATGTCTTAAAAC
	AAATAAGTGAAGTGAGACATTTGTTTCTGGA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+61dbEST_AW761896.1,dbEST_BQ900794.1,dbEST_BQ934333.1,dbEST_BI852210.1,REF_NM_011175.2,GB_AJ000990.1,GB_AF044266.1,GB_AK149666.1,
23+98dbEST_AW018358.1,dbEST_AI987956.1,dbEST_AW761896.1,dbEST_BQ936258.1,REF_NM_011175.2,GB_AK148104.1,GB_AJ000990.1,GB_AF044266.1,GB_BC132515.1,GB_BC132519.1,GB_AK149666.1,
34+93dbEST_AW761896.1,dbEST_BI083329.1,dbEST_BQ936258.1,dbEST_BQ900794.1,REF_NM_011175.2,GB_AK148104.1,GB_AJ000990.1,GB_AF044266.1,GB_BC132515.1,GB_BC132519.1,GB_AK149666.1,
45+96dbEST_BF787784.1,dbEST_BU517936.1,dbEST_CK626050.1,dbEST_BI083329.1,REF_NM_011175.2,GB_AK148104.1,GB_AJ000990.1,GB_AF044266.1,GB_BC132515.1,GB_BC132519.1,GB_AK149666.1,
56+86dbEST_BF787784.1,dbEST_BI100849.1,dbEST_BF780788.1,dbEST_BU517936.1,REF_NM_011175.2,GB_AK148104.1,GB_AJ000990.1,GB_AF044266.1,GB_BC132515.1,GB_BC132519.1,GB_AK149666.1,
67+74dbEST_CK627707.1,dbEST_BF787784.1,dbEST_BI100849.1,dbEST_BF780788.1,REF_NM_011175.2,GB_AK148104.1,GB_AJ000990.1,GB_AF044266.1,GB_BC132515.1,GB_BC132519.1,GB_AK149666.1,
78+54dbEST_CK022250.1,dbEST_BI149376.1,dbEST_BI151858.1,dbEST_BI695932.1,REF_NM_011175.2,GB_AK148104.1,GB_AJ000990.1,GB_AF044266.1,GB_BC132515.1,GB_BC132519.1,GB_AK149666.1,
89+44dbEST_BF137086.1,dbEST_BI650804.1,dbEST_CK022250.1,dbEST_BI149376.1,REF_NM_011175.2,GB_AK148104.1,GB_AJ000990.1,GB_AF044266.1,GB_BC132515.1,GB_BC132519.1,GB_AK149666.1,
910+40dbEST_CB180991.1,dbEST_DV652342.1,dbEST_BF178718.1,dbEST_BF137086.1,REF_NM_011175.2,GB_AK148104.1,GB_AJ000990.1,GB_AF044266.1,GB_BC132515.1,GB_BC132519.1,GB_AK178161.1,
1011+38dbEST_CB180991.1,dbEST_BF687188.1,dbEST_CB055913.1,dbEST_DV652342.1,REF_NM_011175.2,GB_AK148104.1,GB_AJ000990.1,GB_AF044266.1,GB_BC132515.1,GB_BC132519.1,GB_AK178161.1,
1112+48dbEST_BU148859.1,dbEST_AI957092.1,dbEST_BI684448.1,dbEST_BG242714.1,REF_NM_011175.2,GB_AK148104.1,GB_AJ000990.1,GB_AF044266.1,GB_BC132515.1,GB_BC132519.1,
1213+57dbEST_CD775394.1,dbEST_CD774522.1,dbEST_BU148859.1,dbEST_AI746452.1,REF_NM_011175.2,GB_AK148104.1,GB_AJ000990.1,GB_AF044266.1,GB_BC132515.1,GB_BC132519.1,
1314+71dbEST_BF225606.1,dbEST_CD775394.1,dbEST_CD774522.1,dbEST_BU148859.1,REF_NM_011175.2,GB_AK148104.1,GB_AJ000990.1,GB_AF044266.1,GB_AK186254.1,GB_BC132515.1,GB_BC132519.1,GB_AK198177.1,