NIA Mouse Gene Index (mm92)

Exon structure for U034897

chr13 -

Exon1 63598586 - 63598409
	CATTTCCAGCAGCAGAGTATTGCCCTGTGGACAGCTCGGTGGAAGATTCCTGCGTACTGCGTGGGAGATGGAGGCCTCAGAGCCCCAGATGCCGCACGAG
	GTCGGACTGGGCTCGCGGCTGTCGCTACAAAGGGACCGCTGCACATGGCAGGCCAGCAGATGCCAACAGACAGCTTTT
Exon2 63533053 - 63532758
	GCACTGCGCGTGCGTGCGAGCGCGCGCGCAGCCCCACTCCCTTGCGGCCGCGGGAAAATTCCAAACACGTCAAAACAAAAAAAGTTCCGTGAGGCTGTGC
	CAAGTTTTCAAGCCGCAGAAGCCGGGCGGTGGCTTCTTTTCCGCCGCGGCCCAGTCTGCTGAGGCAGCTCTGGGTGAGGACCACCCGGGAAGACCGCCGT
	TTCCTGCTAGGGCAGAGAAGACTCGCGAGAACGTGCGCCCGAGTCTCAACGTGGGCGAGCCGCGCTCCcgcggcgcggtggagctgaggcaggacg
Exon3 63532563 - 63532393
	AGACGCGGTGGGCGTGACCACACGGAAACTGATCTCGGCGGGAGCCCGCACGACTTAGAGGGGCCGCTCCACAAGGGAGAGGAGCCGGAGGGGGGCTGCG
	CCATCGCAGATGAGCCCGGCGGGGCGGGACCGACAGTGAGGGGTGGGGTCTAAGGCCCAAGGTGAAGCTTG
Exon4 63507605 - 63507405
	ggaagcttattctctttgcctatttgctttcactctccctagaaagttcattccttcactggcattagaacgtacttctccagggttctgacatatactg
	cagaccagccgagacagccagccttgtggactgaacaactactagattcttgaaccttccattggtagactgccattgttggactagctggaccatagtc
	t
Exon5 63504346 - 63504150
	GCTGCTGTGAAGGGACAGTGCTGCTCTCAGAGATGGCTCAGGAGTCTGCAGACCTTGCTTCTGACTGTCAGTCTTGGCTGCAGAAGCTTTCTGCATGGGA
	ACAGGCCTCTTCTGAGGAAACCCAGAAGGACACTTGTCTTCACTTGTCCGGGTTCCAGGAGTTCCTGAGGCAGATGTATGAAATCTTGAAGGAGATG
Exon6 63501626 - 63501542
	GATTCTGATGCAATCCTGGAAAGGTTCCCCACAATTGGTCAACTGTTGGCAAAAGCTTGTTGGAATCCTCTCATCTTAGCATATG
Exon7 63499485 - 63499391
	ATGAAAGCCAAAAAATTGTAATATGGTGCTTATGTTGTCTGATGAACAAAGAACCTCGGACTTCTGCAGAGTCAGGACTTAACTCGTGGATCCGG
Exon8 63463000 - 63462887
	GGTTTGTTATCTCATGTACTTTCTGCATTCAGATTCGACATGAAAGAAGTTTGTCTTTTTACCAAAAGTCTTGGATATGAGTCTATTGATTACTATCCTA
	GTTTGCTTAAAAAT
Exon9 63461568 - 63461504
	ATGGTTTTGTCATTAGTGTCTGAGCTCAGAGAGAGTCATCTTAATGGACTGAGCACTCAAAGTCG
Exon10 63453480 - 63453393
	ATCAGCTTCTCTAAAGAAAGCTAAATTTTTACCATCTCTGCTTCTGAACTCAGGACATCAGTCTCCTTTTTATGAAGATTTTGAAACT
Exon11 63448892 - 63448728
	GATGGCTCCTGAGCGCATGATGTCCCTGTCAGAAGTTTGTGTCCCTCTTGTCACTCTGCCTGATATGGAACCCCTGGTAGAGGCTCTACTCACCTACCAT
	GGACATGAGCCCCAGGAAGTCCTGGCTCCTGAGTTCTTCGAAGCTGTAAATGAGGCCTTCTTGTC
Exon12 63441783 - 63441627
	GGAAAAAATTGTTCTACCCACGTCCTCTGTGGTCAGCCTCTGGTTTCGGCATCTCCCCAGTCTTGAAAAAGCAACGCTGCATCTTTTTGAAAAGCTTTTC
	TCCAGCAAGATAATTTGCCTGAGAAGGATGGAGTGCTGTATAAGAGAGTCATTCCTG
Exon13 63433201 - 63433149
	CCTCAAGCAGCCTGCCAACCTGCCATCTTCAGAATTGTTGATGAAATGTTCAG
Exon14 63431928 - 63431829
	GTTTGTGCTGCTGGAAACTGACGGAGCCCCAGAAGTACTAGCTGCTCTTCAGGTTTTCACATCGTGCTTGGTAGAAGCTCTGAAAAAAGAAAACAAGCAG
Exon15 63426934 - 63426859
	CTGACGTTTGCCCTCAGGACCTACTTTCCTTACGGTGCTCCATGTCTTGCTGCAGCGCTGTCCCAGCACCCTGAAG
Exon16 63426326 - 63426218
	GTCTGTAGACATGGCCTGTGACAGGAAGAGGGGGATAGAGGAGGGCTCATGTTTCTGTGCTGTGGCCACTGTGGCTTCTTTCCCTATACTTGAGAAAGAT
	CTGTTTTAG
Exon17 63424797 - 63424716
	CAATCCCACAGGGACACCGGCTCCAGCCTCTGCTGCACATTTCCCAACTCCTCAGAGAAGCAGTTGAAGACTGTACTCGTGG
Exon18a 63423352 - 63423303
	GTCTCCGCGAAATCCCTTTGAGAGCTGGTTTTTGTTTGTTCACTTTGGAG
Exon18b 63423302 - 63423175
	GATGGGTTGACCTGGCTGTGGCAGAGTTACTGCTGAGGGAGGAAGCTGAGCCTCCTGCTGGCCTGCTGTGGCTCTTGGTGTTCTATTACAGCCCACAGGA
	TGGGAGTCAGCAGAGAGAGCAGAGCATG
Exon19 63422970 - 63422607
	GGACCCAGGACAAGAGGCTGCCCCAGCAGTCAGGCTGATCTTGCTCTGGGCCTTCTGTCTTCAGAGTTATTTGATCTGTTCTCCCCAGTGGCCTCAGTTG
	CCCTAATTTATCCTCCTGCCTCACCCCAGGGCTCTATACTTTAGGAGATGCCATGCAGGGCAATAGCTGCTCTGAGAAGGACTGTCCCAAGACAGAGACT
	GGATCCTGGGCCAGTCAGTGCCTTCTCTTGCCCACCAGCAGCCTAACTAGTCTACTTCCATCTCACTGCTTTCCTGCATCAGTCAGACTCGTACTGAGGT
	GATCTTAATCACTTGGGTCATCCAAACAGGGTATCGATGTACAGGACTGTAACTGTGTACAGCA
Exon20 63418864 - 63418661
	GTGGAGCTGAAGGTATTAATCAACCGTCTCCTGATGCTGCTCAGAAGCGGCCCCCTCTCAGCTACTGATCTGCAGGAAGCAGCTGAGAGTCCCAGTGGAG
	ACCCCAGACCACCTGTATGTGGACAGCTGGTCAGACGCCTTCTTCTTAGTCTCTTGCTCTGGACCCCAGAAGGCCATGCAATTGTCTGGGAAGCTGTCAC
	CCAT
Exon21 63418590 - 63418492
	GGTCCGACTTTTGAGATCACAGGCCCAGGATGCTGCCCCAGGATATGGAGATCCACAAGGCCACAGCACAGACCCAGAGCCCACCTGTGCTGTACAGAG
Exon22 63414111 - 63413971
	ATGGCCCACACGGATGCTGTAATCCATGAGATTATTGGTTTTCTTGACCAGACCTTGTACAGATCACAACATCTTTGTGTTGAAGCCTCGAGAAAACTGG
	CCAGAGACCTCCTAAAGGAGCTGCAAGCCCAGGTCTAGCAG
Exon23 63413185 - 63413062
	GCTTTGCCGGGCAAACACTGACTGGCAGTGGATTCGTCTTTTACCCACCTGCTGATGGGCTCACAGTGGAGTGGAGCTGGACTTTCTACTTTTTCATTCT
	GAATAAAAAGTTGTACTTAATTTT
Exon24 63407176 - 63406017
	AACACGGACATGGACACTCCCAGCGGGATCAACCACCAAGGCAGGGCTTCTTTCTGGCCAGTCTTCCCACTGGGGCTACACATGCCAACACCAAGAGCCG
	GTCTCCTCAGCAGCCCACCCCATCCTGGGAAACTTCCTCCGCTTGCCCCAGTCTCCTCCCTGTCTCACACTGTCTGGTCATTGGTCTGAAGAGAACTGCC
	TTATTGGTTCATCAATCTCTCCGACAGCATCAATGGGTGGGAAGGGGGCCATAAAACCGTCCCCTGAATAGCCGGATGGCTGCTCCTCCCTCCCACCTCG
	TAAACCCCACAGACCAGCCAAGGGGCCCCCGAATTCACTGTGGCTAGGGTGAGTTCACCCCCCTCACTGAGACTACTCCCTGAAACCTTTCTTGGGAGGT
	CCAGGCACTCCCCACCCACGCCAGCCCTGGGAGTCTCAGAGATGTGATGAGGCTAGGCCACTCCCTAGGGAGAGAGTGTTCCAAGGGGCTGAATAACCAC
	TGAGCTTTTGGAAACAATGTTAAGCCGCAGCAAGGTGTCTACATACTGTGGGAATGGGTATGGCAGCCCAGCCACTCAGGGAGCAGGCCAGCTAAGGCCA
	CAGGCCCAGCACCCAGGACTACTTGGCAGGTGTAGCTGGGGCGGGGTGTTCTCCTTTCCCTTACCAGGCCAGTGCTGTTCCTGTACTGGCTGGCTCCGTC
	TCTGTATAAGCCTGGTGGGGACCAGCAGGACTGAAGCAAGCAGCTCTGCATGTGAACCCTTCAGATCCCATCCTCTAAGTACTGCTTTCTGTTGCTTCCT
	GGGCCATAGCTGCTTTGGAGAGTTGGGGCAAAGGTGATGCTGTGGATAACAGAGATCCCTGTGTGTGTGGCATCCCCTGCTAGCTGGCCGCTCACTGGGC
	TTGTGTAGCCATGTCCTGCTAAGCCACGGTCAGGAGAAAAACCTGGTAGGAACTTGGCACTGGCCTGGAGTGGACCCTGAAAAACCCTCTGCGTTTGGTA
	AGGACTGCTTACTTTGGGATATCTGCCATTTCTGGTTTCTACCCTGGGGACATTCTATGACATTTCTGCTCACCACAAGCAAGAATACCTTGCTATAGTA
	TCAATTATTTCATTCTTTTGATGTGAAATTCGTTTGAATAAATAAATACATAAATGCTTT
Exon25 63386842 - 63386349
	GAATGGGAGGGCAGCCTTCCAGCAGGCCCTAGAAACACTCTCGCTATAATCACAGATTCCTTATTCAATACCAGACCCAGAGCTTGACAGTGACCTGCAC
	AGAACACTGGAGGCCTTACTTACCTCACTCCTTCTCTGTGGAGGCTTGGCACATGACCCCGCTACTGAGGTCTCTTTGGCCATCTTTCAGGTGGCTCCTA
	CTTATTCTGTATCTGAGAACCCTGACAACTGGATGGAATGCCCTTGCTTGCTCAGTTACAGGGGAATAGTGGAAACCAAGTTAGAAACCTCAAGGTTGTT
	TCCACCAAGGAACAACTCTTTCTCCTGTCGACTGTCTGTCACTCAAATGAAAGTTGCTAATGGTTCAACTTAGTTCCTGCGGCCTAGTCACCAGAAGGCA
	CACTTAAAATTTGAAGTTTCTAGAAAACAACATGGTTGCTGAAAATCATGTTGATCTTCAGATTCAAAGTGATATTTTACAGGAACTTCAGTAC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
35+8dbEST_AW107028.1,dbEST_BX528457.1,dbEST_BY313485.1,dbEST_BY314215.1,
15+2dbEST_CD351140.1,ENSMUST00000159024,
45+2dbEST_CX238751.1,ENSMUST00000162375,
25+31dbEST_BU707209.1,dbEST_BB628006.1,dbEST_CA750725.1,dbEST_BU707114.1,REF_NM_001042673.1,REF_NM_007985.2,GB_AK080697.1,GB_AK035488.1,GB_AK042226.1,GB_AK147025.1,GB_L08266.1,GB_AK163161.1,GB_AK196042.1,
26+8dbEST_BI696555.1,dbEST_BB650368.1,dbEST_BY089785.1,ENSMUST00000099444,GB_BC038609.1,GB_AK082717.1,
56+35dbEST_CF748566.1,dbEST_BU707209.1,dbEST_AW107028.1,dbEST_CX238751.1,REF_NM_001042673.1,REF_NM_007985.2,GB_AK080697.1,GB_AK035488.1,GB_AK042226.1,GB_AK147025.1,GB_L08266.1,GB_AK163161.1,GB_AK196042.1,
67+42dbEST_CF949820.1,dbEST_CF748566.1,dbEST_BI696555.1,dbEST_BU707209.1,REF_NM_001042673.1,REF_NM_007985.2,GB_AK080697.1,GB_AK035488.1,GB_AK042226.1,GB_AK147025.1,GB_BC038609.1,GB_AK082717.1,GB_AK163161.1,GB_AK196042.1,
78+39dbEST_CF949820.1,dbEST_CN723140.1,dbEST_CF748566.1,dbEST_BI696555.1,REF_NM_001042673.1,REF_NM_007985.2,GB_AK080697.1,GB_AK035488.1,GB_AK042226.1,GB_AK147025.1,GB_L08266.1,GB_BC038609.1,GB_AK082717.1,GB_AK163161.1,
89+34dbEST_AI326733.1,dbEST_CF949820.1,dbEST_CN723140.1,dbEST_CF748566.1,REF_NM_001042673.1,REF_NM_007985.2,GB_AK080697.1,GB_AK035488.1,GB_AK042226.1,GB_AK147025.1,GB_L08266.1,GB_BC038609.1,GB_AK082717.1,GB_AK163161.1,
911+32dbEST_AI326733.1,dbEST_CX768192.1,dbEST_CF949820.1,dbEST_CF748566.1,REF_NM_001042673.1,REF_NM_007985.2,GB_AK080697.1,GB_AK035488.1,GB_AK042226.1,GB_AK147025.1,GB_L08266.1,GB_BC038609.1,GB_AK082717.1,GB_AK163161.1,
1011+7dbEST_CA553187.1,dbEST_CA550670.1,dbEST_BQ559931.1,ENSMUST00000161656,
912+3dbEST_CN723140.1,ENSMUST00000160735,NIA_E0854H08-5,
1112+29dbEST_AI326733.1,dbEST_CX768192.1,dbEST_CA553187.1,dbEST_CF949820.1,REF_NM_001042673.1,REF_NM_007985.2,GB_AK080697.1,GB_AK035488.1,GB_AK042226.1,GB_AK147025.1,GB_L08266.1,GB_BC038609.1,GB_AK082717.1,GB_AK163161.1,
1213+27dbEST_BM948131.1,dbEST_AA387027.1,dbEST_AA153700.1,dbEST_AI326733.1,REF_NM_001042673.1,REF_NM_007985.2,GB_AK080697.1,GB_AK035488.1,GB_AK042226.1,GB_AK147025.1,GB_L08266.1,GB_BC038609.1,GB_AK082717.1,GB_AK163161.1,
1314+26dbEST_BM948131.1,dbEST_AA387027.1,dbEST_AA153700.1,dbEST_AI326733.1,REF_NM_001042673.1,REF_NM_007985.2,GB_AK080697.1,GB_AK035488.1,GB_AK042226.1,GB_AK147025.1,GB_L08266.1,GB_BC038609.1,GB_AK082717.1,
1415+24dbEST_BM948131.1,dbEST_AA387027.1,dbEST_DV661740.1,dbEST_AA153700.1,REF_NM_001042673.1,REF_NM_007985.2,GB_AK080697.1,GB_AK035488.1,GB_AK042226.1,GB_AK147025.1,GB_L08266.1,GB_BC038609.1,GB_AK082717.1,
1617+2dbEST_BI645776.1,ENSMUST00000160336,
1517+24dbEST_BB277165.2,dbEST_CA979627.1,dbEST_BM948131.1,dbEST_AA387027.1,REF_NM_001042673.1,REF_NM_007985.2,GB_AK080697.1,GB_AK035488.1,GB_AK042226.1,GB_AK147025.1,GB_L08266.1,GB_BC038609.1,
1718a+29dbEST_BB277165.2,dbEST_BI645776.1,dbEST_CA979627.1,dbEST_CA559190.1,REF_NM_001042673.1,REF_NM_007985.2,GB_AK080697.1,GB_AK035488.1,GB_AK042226.1,GB_AK147025.1,GB_L08266.1,GB_BC038609.1,
18b19+2dbEST_DV661740.1,ENSMUST00000159056,
18b20+24dbEST_BQ947543.1,dbEST_BQ445340.1,dbEST_BI645776.1,dbEST_CA979627.1,REF_NM_001042673.1,REF_NM_007985.2,GB_AK035488.1,GB_AK042226.1,GB_AK147025.1,GB_L08266.1,GB_BC038609.1,
1520+2ENSMUST00000160333,GB_AK082717.1,
2021+3ENSMUST00000163091,ENSMUST00000021916,GB_L08266.1,
2022+20dbEST_BQ947543.1,dbEST_BE573881.1,dbEST_CB317300.1,dbEST_BQ445340.1,REF_NM_001042673.1,REF_NM_007985.2,GB_AK035488.1,GB_AK042226.1,GB_AK147025.1,GB_BC038609.1,
2122+3ENSMUST00000163091,ENSMUST00000021916,GB_L08266.1,
2223+1ENSMUST00000160166,
2224+5ENSMUST00000073029,ENSMUST00000021916,REF_NM_001042673.1,GB_AK035488.1,GB_AK042226.1,
18a25-2dbEST_BB277165.2,GB_AK080697.1,