NIA Mouse Gene Index (mm92)

Exon structure for U035383

chr14 -

Exon1 32643837 - 32643513
	gggctggagcggcgcggcggcgggggcTGCTGGGGTATTTCGGGAAGGGGGTGTGAGGCGGCGGCGAAGGCGGCGGCTGCGTGTGGGAGGTGGCTGAGAG
	CTAGAGGGAGAGAGCGAGAGAAAGGACGGAAGAAAGAGGGCGGGAGTCCTTGGAGGAGGCGGGACCGGCGGGGCTCTTCgcggcggcggcggcggcgggc
	ggccggggaggcggcgCCGCCCCCTGCCCGCGCTCTCTTCAACGTAGCCGGCCACCTACCCGCCGGGCGCGGGTAGTGGCCGAACAGCGGCGACCGCCAT
	GGCGTTCCTCAAACTCCGCGACCAG
Exon2 32593657 - 32593351
	TTTTTATTTTTAGGAAGTTATGTACCATAATTTTAAACTTAAGTTTCTCTAATATTACTAACTATAAAACCAGCGGCACTGTTCAGAGAATGTTTATAAG
	TGGTGTACAGAAGAGGAGGAAAAACTGCTTGTGCTCGTCCCACTGTGACTTTTATCACATAGCTTGGAGTTTAATGTTTTAAAAGAGCGAATGAGTCGAG
	TGTGTATTGTTGTTTTGGAGGAGGTAGAAGATGATTCTCCTGTATTCATTTCTAAGTTGCCCCAGGAAAGTACATGTCTACAACCTCCACCTTCTGGAAA
	TGTGTTG
Exon3 32592191 - 32592108
	CCATCACTGGTGCAAGCTATATTTAATGGTGATCCAGATGAAGTCCGAGCACTAATATTTAAGAAAGAAGATGTTAACTTTCAG
Exon4 32577518 - 32577440
	GACAATGAGAAGAGAACCCCTTTGCATGCTGCTGCCTATCTTGGTGACGCAGAAATCATTGAGCTGCTTATTTTATCTG
Exon5 32568989 - 32568919
	GAGCTAGAGTTAATGCCAAAGACAGCAAATGGTTGACACCTTTACACAGAGCAGTTGCATCGTGTAGTGAG
Exon6 32562029 - 32561829
	GAAGCAGTTCAGATACTTTTGAAGCATTCTGCAGATGTTAATGCTCGAGATAAAAATTGGCAGACCCCTTTACACATAGCTGCTGCTAATAAAGCTGTAA
	AGTGCGCTGAATCTTTGGTACCTCTTCTGAGCAATGTGAACGTGTCCGACCGAGCAGGAAGAACTGCATTACATCATGCAGCTTTCAGTGGGCATGGTGA
	G
Exon7 32560186 - 32560099
	ATGGTCAAACTACTCTTGTCCAGAGGTGCCAATATAAATGCTTTTGACAAGAAAGATAGGCGTGCAATCCATTGGGCAGCATATATGG
Exon8 32558549 - 32558407
	GTCACATTGAAGTAGTAAAATTACTTGTATCTCATGGAGCTGAAGTGACATGTAAGGATAAGAAGTCTTACACACCTCTTCATGCAGCAGCCTCTAGTGG
	AATGATCAGTGTAGTCAAATATCTTCTAGATCTTGGAGTTGAT
Exon9 32556621 - 32556409
	ATGAATGAACCAAATGCCTATGGAAACACACCTCTTCATGTGGCCTGTTACAATGGACAAGATGTTGTTGTGAATGAGCTCATAGACTGTGGTGCTAATG
	TCAATCAGAAGAATGAGAAAGGGTTCACTCCTTTGCACTTTGCTGCTGCATCAACACATGGAGCACTGTGTTTAGAACTTCTGGTTGGCAATGGAGCTGA
	TGTCAATATGAAG
Exon10 32556395 - 32555952
	AGAGTTCATACTTTAAGGATGTAGTTAACTGTCTAAAACAGTATTCATAACATATCATCCAGAATTATAAAGGATCCACTAGTAAACTTATGAACATGGA
	TAAGgccagatgtggaggtgcacaccttaatcccagcacagtggaggcagaggcaagcagatctctcagtttgaggccagcagagctacacactaagacc
	ctgtctcTACTGTCAACCCCACCACCCCTCCCAAAaagaacatggatgaagtttttaaatcttatgctgaatcaaagaaagaattgtatacatttttttc
	ctctgtgtaagattctagaacagatggaattctgtttatttggagttccagaatttatagttggggaaaaataacagatcagttgttgcccatgggaagg
	aaggaaaggtcacctgggcaagggacatgaggagaccttatagg
Exon11 32550024 - 32549946
	AGTAAAGATGGGAAAACCCCACTACATATGACTGCCCTCCACGGTAGATTCTCCAGATCACAAACGATTATCCAGAGTG
Exon12 32548272 - 32548158
	GAGCTGTAATAGACTGTGAAGATAAGAATGGGAACACCCCTTTGCATATAGCAGCCCGGTATGGCCATGAGCTTCTAATCAACACTCTTATTACAAGTGG
	TGCTGACACTGCAAA
Exon13 32546952 - 32546870
	GCGTGGTATACATGGAATGTTCCCACTCCATTTGGCAGCCTTAAGTGGTTTTTCAGATTGCTGCAGGAAACTCCTTTCTTCAG
Exon14 32545278 - 32545215
	GATTTGACATAGATACCCCAGATGATTTTGGCAGAACCTGTCTACACGCAGCTGCAGCTGGAGG
Exon15 32543139 - 32543071
	AAATTTGGAGTGCCTAAACCTTCTGCTGAATACTGGTGCAGACTTCAACAAAAAGGATAAATTTGGAAG
Exon16 32540961 - 32540821
	ATCTCCACTGCACTATGCTGCTGCCAACTGCAATTACCAGTGCCTGTTTGCTCTTGTGGGATCAGGAGCAAGTGTGAATGACCTTGATGAGAGAGGCTGC
	ACACCCCTGCACTATGCAGCTACATCTGACACAGACGGCAA
Exon17 32535143 - 32535032
	GTGCCTGGAATACTTACTAAGAAATGATGCCAACCCAGGGATCCGGGACAAACAAGGCTATAATGCAGTTCACTACTCAGCTGCGTATGGTCACCGTCTG
	TGTCTTCAACTG
Exon18 32533318 - 32533292
	ATTGCAAGTGAAACTCCTTTAGATGTT
Exon19 32532601 - 32532527
	TTAATGGAAACCTCGGGAACAGACATGTTGAGTGATTCAGATAATAGAGCAACAATAAGCCCTTTACATTTGGCT
Exon20 32528621 - 32528420
	GCTTATCATGGTCACCATCAAGCCCTGGAAGTGTTGGTACAGTCTTTGTTAGATCTTGATGTAAGAAATAGTAGTGGTAGAACACCCTTAGATCTTGCAG
	CCTTTAAGGGCCATGTTGAATGTGTGGATGTACTCATTAATCAGGGAGCTTCAATCCTCGTAAAAGATTACGTTTTGAAGAGAACACCTATCCATGCAGC
	AG
Exon21 32525202 - 32525115
	CAACAAATGGTCATTCAGAATGCTTACGGTTATTAATAGGAAATGCAGAGCCACAGAATGCAGTAGATATTCAAGATGGAAATGGACA
Exon22 32524362 - 32524245
	GACACCTCTTATGCTGTCGGTTCTCAATGGGCACACGGACTGTGTATACTCACTACTGAACAAAGGAGCAAATGTAGATGCCAAAGACAAGTGGGGAAGG
	ACAGCGTTGCACAGAGGG
Exon23 32524157 - 32523938
	GCAGTGACAGGCCATGAAGAGTGTGTAGACGCATTACTTCAACATGGTGCTAAGTGCTTACTACGGGACAGCCGGGGTCGGACACCCATACACTTGTCAG
	CAGCCTGTGGACACATTGGAGTTCTTGGAGCCCTTTTGCAGTCAGCAACATCTGTGGATGCAAATCCAGCCGTAGTAGACAATCATGGGTATACAGCACT
	TCACTGGGCTTGCTACAATG
Exon24 32522191 - 32522104
	GTCATGAGACATGTGTGGAGCTACTTTTAGAACAGGATGTTTTCCAGAAAATAGATGGAAATGCTTTCAGCCCCCTGCATTGTGCCGT
Exon25 32522019 - 32521936
	GATCAACGACAATGAAGGTGCAGCTGAGATGCTGATTGATTCCTTAGGAGCCAGCATTGTGAATGCCACAGACTCAAAGGGAAG
Exon26 32521334 - 32521189
	AACTCCTCTCCATGCCGCTGCCTTCACAGACCATGTGGAGTGTTTACAACTGCTGCTCAGCCAGAATGCTCAGGTCAATTCCGCAGACTCTACCGGAAAA
	ACACCTCTCATGATGGCTGCAGAAAACGGACAAACCAATACAGTTG
Exon27 32520472 - 32520390
	AGATGCTGGTTAGCAGTGCTAGTGCAGATCTGACATTACAAGATAAGAGTAAAAACACCGCCCTTCATTTGGCTTGTGGCAAG
Exon28 32520058 - 32519976
	GGTCATGAAACTAGTGCCTTGTTAATTCTGGAAAAGATAACAGATAGAAACCTCATCAATGCAACCAACGCAGCCTTGCAAAC
Exon29 32518542 - 32518451
	ACCTCTGCATGTTGCTGCCCGAAATGGGCTCACGATGGTTGTTCAAGAGCTCCTGGGGAAAGGAGCCAGTGTGCTTGCTGTTGATGAGAATG
Exon30 32515492 - 32511954
	GCTACACCCCAGCTTTGGCCTGTGCTCCCAATAAGGATGTGGCTGACTGCCTGGCTCTCATTTTGGCCACCATGATGCCTGTCTCGTCAAGTAGCCCATT
	GACATCCCTGACATTCAATGCCATTAACCGTTATACCAACACCTCAAAAACAGTTAGCTTTGAAGCCTTGCCTATCATGAGGAATGAAGCCAGCTCCTAC
	TGCAGTTTTAACAACATTGGTGGCGAGCAGGAGTACTTGTACACCGACGTGGATGAGCTCAACGACTCTGACTCCGAGACCTACTGAAAGGCCGAGTGAG
	CTGCAGCTCTAAGGAAGTTCTGACACTGAAACTTCAAATCGGGCTTTTTCGGGAAAAAGGCACTTTCTTATCATACACAGATTCAACCTGAAGAAAGATC
	ATGCAGTGAACGAATGGAAGAAACATGATGACATTAGGAAGAAGAGTCTTAAAGGCAAGTTTTGCAAAAGGAACTTCTAGAATCTTAATAATGACTTGAC
	CAGTGGAAAACACAGTGATGTCGATTGCTTTGTGGGATCGTTTAATTGGCTTTGCAGTGCCAGAAATTGGGACACTGCTCCCTGACCTGCTTACATGGGC
	AACACTGCTGTAAAGAAAGAGATCAAAACACTAGATTAAATTTTACCCATAAAATTACAGCTAAATTTTAATGCAATAAAAGTTTGGTATAATAGGCATT
	ATGTACACATCAAATTGCCAAGGACCAAATAACATACAGATTTTTTTATTAGAACTCCATTTTGTGGAAACGGAAATAGATGAAATGAGAAGTCGTCTAA
	AGCAAACTTCAGTGCTTCTGAAAGTGAGGCCAGATTCGGTTTGGTGTTGGTTTTTATAAGAAAGCATCTACTGTATTAAGCCATGAGAGGAAGCAGATGt
	atttttacattttttaatataaaagtttttaaattCCACTTTTTATAGACTTCAGAACCAGTTAACTGGGTGCAGCGTGGTTGAAAGTACTAGAGACAGA
	CGCAGATGAAGTCAGGGCTGTTGCCCACGATTGAGTGGTTTGCTTTTAAATTGAATTGTTTTTGTTTAAGGAATTCCATAGAGGAAATTTTTAATGAATT
	TAAAAAACAGACTATTTCACCTCTTGTAATGCAGCGGTCCTGGAGAAGGGACATCTGAGCCTCTCTGTGCGCGGCACACCTGCATCACGTTAGTTACTTT
	GGGACCTCTACCTTTTTTGGCTGGAGGAATTCTATTGTCATTTATTTTAATCTTTGAACTTTAAAAACAAGAATCAAAATTTTAAAAAGTTTGAAGACTC
	TTGTTATGAAACATTGTCGAAAGCTGGTTGTGAATTCTATACAAACTGGGATTGTAAATGTTTTATGTAAAAGAAAATACTTAAAAATGTACCTGCTTCC
	TCTCCTGCGTCCTCACAGCACTGGAAGGTTCTTGAATGCATCCTTTCCTttgttgttgttgttgttgttgtagtcgtttgttgttttaagacagggctct
	ctatgtgtagccctggctgtactagagtttgctttgtagaccaggctggcctcgatctcacagagattcacctgtctcagcttcctaagtgctgggatta
	aaggtgtgcaccaccactgcctggctTCAGATGTTTTCTTTATAAAAATCAACATCAAACCATTTGGCTTCCTTCTCAGAAGCATTGGAGTTTGCTTTAG
	ATGATGACTCATAACATAAACAGAATCAGGTCATTTGGAAGGCATTTCTGTACTGGGCAAGATTTAAAATACTTCAGGCTTTAGGTCCTCCTGAGATCTA
	GAGTAGCGGGTGTGCAGCTTCTTACTGTCAGAGCTTGCCTGCCAAATTGAAGACTGCCTTTCAGGTAACAGAGAAGAGGCTGACAGTAGGCTAATTTTAA
	ATTACACTTTTCTGTGGTTCTTTTATTGTAACTGTCACTTTCCCAGTAACAATGATTTTACATTGGGGGGAGGGGTCTTACTAGAGCTGGGTAAAGTTCC
	ATACATTGCAACAAAATGATACCCAATTCCATCTTACCCTTTTTGTATTGTGAAACTGGAACTTTATGACATTGTAAATTATCAGCTGGTTTTTCTGAAT
	ATAAAGTGTGAAAACACAGAACAGTATTTTGATCTATTTGATAATTTTGTGGGTTTTTTGAAGAATTAATGAGCATGTACATAGAAATAGTGACTGCTTG
	AATCCTGTATTTACTTGCACTCTTTCAGTACATCAAGATTCCTGTATATTTTAGAGTATAATAAAACACAGACGTGAGCTGTATTTAATGAATAATGTAT
	TTGTATCTGTGCATATTACTTAAAAATCTATAAAGTTTCTAGGGCATTGACTACTAGATTTTAAGCATTTTTCTAAAATATTTGCAAAATTATAAATATA
	ATCTCCATCTTTTCTTTATAATATAAAGGAGTCGTAATGAACCCTTCGTAATTAATAGTGGGAGAAGGGTAAATATGCATTTTAAAAGACCGTAGACTAC
	ATTTCTATTGTACCTTTTAAAAAAGAAAACTCAAGAGGATTCTAAAAGTATACCATATGTGTGCTTTCTCTTTCCTTTTAGGAATTCTCTTCTGAATTCC
	CTGAGGGAATTTTCtagaatctcagaattgaaagagacctgaggtccatccagtctaacctcttaaatgcaggagtcccttctccaaggttgtctttcca
	ccttgaacacttccagtgactacctcacgagcagtccattcattgttgagcagctctgttaggaaggtctccttaatggagctgaagcctccctcctggt
	aacttctgtccttgggcccagctctgtcctccaagggaatgctggaaggatgactttccaccctctgccatgtCTTCTCTTTCACAGGCTGAAGTGATTT
	CCAGATGGACTCATTAGACACATTGTCTGCACATCTATTGAAGTCAAATGTGTAGCTATAAAGTAACAAACTCATCTTTTAATTTATCCTCATATGTATG
	TAGAGACCAAGATCCTGCATCACTTTAAGTAAAACACTCGGGAGGTGGTTTGTGCTGTTACCAGCCGACTAGAAAAGCTGTTCCTTTGTGGTAGTTTGTC
	TCTAGCTTGAGCAACCCACTTCCTTTGGTGTGCACTGGAAGAGGGAAATTTTGAAGTACTATCCCAGAAAGTGTTGACTAACACCAGTATTTGGAATAAA
	TACAGGAGCACAGCATAGCGCCATACGTTACTTTATAGTTACATACACCTATAGTGTGCACAAAGCATTGGTCCTGGTGGGTCGGTTGTGTATTTATCCT
	CGCCCACAAGGGGAAAGTCTGTCGGCCTTTAATTTCTGTGAGAAAGGTGACATCTAAGATATGTGTTACAGAAATACCAGCTTTTGCTCAGAAACAACTT
	TGGGGGAGATAACGATGACAGGTGACCTCAAACAGTGCCATTTAGTTCAGAGATCTCTAAATGTAGCTGTAAATTTGGGGTTAATTTGGCTTCAAATATT
	GGATCttttaaatgaaataaaaatttttaatgtaaaaaa

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+8dbEST_BQ900467.1,dbEST_CB246055.1,dbEST_CJ060744.1,dbEST_BB866401.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,
23+2dbEST_BF472162.1,dbEST_BE947201.1,
34+9dbEST_CV557641.1,dbEST_BQ900467.1,dbEST_CB246055.1,dbEST_CJ060744.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,
14+4dbEST_CA870677.1,NIA_K0904B04-5N,NIA_K0905B04-5R,NIA_K0905B04-5N,
45+15dbEST_CA752188.1,dbEST_CV557641.1,dbEST_BQ900467.1,dbEST_CA326675.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,
56+15dbEST_CA752188.1,dbEST_CV557641.1,dbEST_BQ900467.1,dbEST_CA326675.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,
67+17dbEST_CB518990.1,dbEST_CN456086.1,dbEST_CN538431.1,dbEST_CN455929.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,
78+19dbEST_CB518990.1,dbEST_CN456086.1,dbEST_CN538431.1,dbEST_CN455929.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,
89+18dbEST_BB358272.2,dbEST_CK638709.1,dbEST_CB524775.1,dbEST_CO430986.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,
1011+3dbEST_BB614810.1,dbEST_BB616590.1,GB_AK133330.1,
911+23dbEST_CB521155.1,dbEST_CD348754.1,dbEST_CN535182.1,dbEST_AW740971.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,
1112+27dbEST_CF745216.1,dbEST_CB722611.1,dbEST_CB521155.1,dbEST_CD348754.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
1213+28dbEST_CV556935.1,dbEST_CN457875.1,dbEST_CF745216.1,dbEST_CB722611.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
1314+28dbEST_CV556935.1,dbEST_BP761600.1,dbEST_CN457875.1,dbEST_CF745216.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
1415+28dbEST_CV556935.1,dbEST_BP761600.1,dbEST_BE914619.1,dbEST_CN457875.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
1516+22dbEST_CK633673.1,dbEST_CV556935.1,dbEST_BP761600.1,dbEST_BE914619.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
1617+20dbEST_CD803212.1,dbEST_CK639364.1,dbEST_CK633673.1,dbEST_CV556935.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
1718+15dbEST_CF747004.1,dbEST_CD803212.1,dbEST_CK639364.1,dbEST_CK633673.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
1819+15dbEST_CF747004.1,dbEST_CD803212.1,dbEST_CK639364.1,dbEST_CK633673.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
1920+17dbEST_BU512466.1,dbEST_CN533205.1,dbEST_CD347884.1,dbEST_CF747004.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
2021+17dbEST_CV559504.1,dbEST_CF530753.1,dbEST_BU512466.1,dbEST_BE372243.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
2122+19dbEST_CF746895.1,dbEST_CV559504.1,dbEST_BQ949349.1,dbEST_CF530753.1,REF_NM_001024604.2,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
2223+20dbEST_CA980186.1,dbEST_CF746895.1,dbEST_CV559504.1,dbEST_BQ949349.1,REF_NM_001024604.2,GB_AK220336.1,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
2324+24dbEST_CB524403.1,dbEST_CV559542.1,dbEST_BB615082.1,dbEST_CA980186.1,REF_NM_001024604.2,GB_AK220336.1,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
2425+30dbEST_CB245677.1,dbEST_CA326912.1,dbEST_CN455169.1,dbEST_CA328012.1,REF_NM_001024604.2,GB_AK220336.1,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
2526+29dbEST_CB245677.1,dbEST_CA326912.1,dbEST_CN455169.1,dbEST_BI250252.1,REF_NM_001024604.2,GB_AK220336.1,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
2627+21dbEST_CB245677.1,dbEST_CA326912.1,dbEST_CN455169.1,dbEST_BI250252.1,REF_NM_001024604.2,GB_AK220336.1,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
2728+23dbEST_CK624114.1,dbEST_CB245677.1,dbEST_CA326912.1,dbEST_CN455169.1,REF_NM_001024604.2,GB_AK220336.1,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
2829+16dbEST_CK624114.1,dbEST_CB245677.1,dbEST_CA326912.1,dbEST_CN455169.1,REF_NM_001024604.2,GB_AK220336.1,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,
2930+15dbEST_CO432888.1,dbEST_CO431100.1,dbEST_CK624114.1,dbEST_CB245677.1,REF_NM_001024604.2,GB_AK220336.1,GB_BC051456.1,GB_BC094609.1,GB_AK133330.1,