NIA Mouse Gene Index (mm92)

Exon structure for U035628

chr14 -

Exon1 58364960 - 58364727
	CCGTGGAATGCCAACAATGTAGCGAATGTCCCGCTCGGGTCTGCGCTTCGGAACCGCGGCGTGAGCGCCCCGGGAAGATGGAgccgccgccgccagcgcc
	gccgccgcTTCCCCGGGCTCCCCCGACCCTCCGGGGTCAGCAACCACTGCCGCCACCGGCGCCCGGTCTCCCGGCGCGCGAGGTCCCGGAGCCGCGGGCC
	AGGACGCCGCCGAGGGTGTAGAGCGCTCCCGGAG
Exon2 58353255 - 58352715
	AGAGTGATGGTCTTCAAAATGAAAACTCTGGAAAATTTTAGGTTCTCTTTAGGAACTACAAAAATTGAAGGACAGCAATTTTTTGAAAGGAAGTTGTTCT
	GAAAGCATGTTTACAATTCACTGACACTGTTGACTGTTCTCTTTAAAATAATAAGACGCTTTGAGAAGATTGTATTTATGGTAAAAGGAAACTGGACTAA
	CAATGAGGCCAAAGACTTTTCCTGCCACAACTTACTCTGGAAATAGCCGGCAGCGATTGCAAGAGATTCGAGAGGGGCTGAAGCAGCCATCCAAGGCTTC
	CACCCAGGGGCTGCTGGTGGGACCAAACAGTGACACTTCCCTGGATGCCAAAGTCCTGGGGAGCAAAGATGCCTCCAGGCAGCAGCAAATGAGAGCCACC
	CCGAAGTTTGGACCTTATCAAAAAGCTCTCAGGGAAATCCGATATTCCCTCCTGCCTTTTGCCAACGAGTCAGGCACTTCGGCAGCTGCAGAGGTGAACC
	GGCAGATGCTTCAGGAGTTGGTGAATGCGGGATGTGACCAG
Exon3 58343658 - 58343411
	CAAGAGAGCCTTGGCTGGTGACAAGTGACATCTGGGAGTTCTCAAGAATGTGGCAGAGTAGAACAGAGTGAACCCCTCGTCAGCTGTCTCTTTAGTGTCT
	TCGAGGCCGCTCCAGGAAGCTTTGTGGCTGCTGCCTTCTCTCTTTGCCTCCAGCCTTCTGTTCTGCCTGGCTGTTGCTTCCTGGTTTTCTGATTTACTTT
	GGAAATGTTCAGCAAGCAGCAGTAGCCTCCCCCAGCTGGAATGAGCCA
Exon4 58341683 - 58341537
	gtggccttgaactcacagagatatgtttgcctcagcctctcaagtgctggggtgaaaggcctgtgtcaGAAATGCGTCTTCATAAGGAAGGTATCAGTGG
	CTGATCGCCTGTGTTCCAGGCTGTGGAAGATCTTGAACCGGTCAACA
Exon5 58341388 - 58341026
	atgcatattcctggtgcgtgtctgtttctggagatgctcctgtctgtccctcccatctcccaaacagcagcacctggattacaggcacacaggctgctac
	agctttgcagtgtgtgcgaattcaagctcggaccctcacacttgtacctgaagcacggagccagccgtcttctcagccccTTATGTCCATAATACTAGGG
	CTTGATTCTGAACGTGAgaggaaatgtggcacttggctttctgaacttggctgattttgctccatggatgacctcaaattgcatccatggttacagtttt
	ttgtcattcttacaaatgtgactttgtccttcgatatggcctaataaaacgcctttgtgctta
Exon6 58321891 - 58321759
	GAGATGGCTGGCAGAGCGCTCAAGCAGACGGGCAGTAGGAGTATCGAAGCTGCCTTGGAGTACATCAGTAAGATGGGCTACCTGGACCCCAGGAATGAGC
	AGATTGTGCGAGTCATCAAGCAGACCTCCCCAG
Exon7 58319395 - 58318095
	GAAAGGGCCTGGCGCCCACCCCGGTGACTCGGCGGCCCAGTTTCGAGGGCACAGGGGAAGCACTCCCATCCTACCACCAGCTGGGTGGTGCAAACTACGA
	GGGCCCCGCCGCACTGGAGGAGATGCCGCGGCAATATTTAGACTTTCTCTTCCCTGGAGCCGGAGCCGGCACCCACGGTGCCCAGGCTCACCAGCATCCT
	CCCAAAGGGTACAGCACAGCAGTAGAGCCAAGTGCGCACTTTCCGGGCACACACTATGGTCGTGGTCATCTACTATCGGAGCAGCCTGGGTATGGGGTGC
	AGCGCAGTTCCTCCTTCCAGAACAAGACGCCACCAGATGCCTATTCCAGCATGGCCAAGGCCCAGGGTGGCCCTCCCGCCAGCCTCACCTTTCCTGCCCA
	TGCTGGGCTGTACACTGCCTCGCACCACAAGCCGGCGGCTACCCCACCTGGGGCCCACCCATTACATGTGTTGGGCACCCGGGGTCCCACGTTTACTGGC
	GAAAGCTCTGCACAGGCTGTGCTGGCACCGTCCAGGAACAGCCTCAATGCTGACTTGTACGAGCTGGGCTCCACGGTGCCCTGGTCTGCAGCTCCACTGG
	CACGCCGCGACTCGCTGCAGAAGCAGGGTCTAGAAGCCTCGCGGCCGCATGTGGCTTTTCGGGCTGGCCCCAGCAGGACCAACTCCTTCAACAACCCACA
	ACCTGAGCCCTCACTGCCCGCCCCCAACACGGTCACCGCCGTGACGGCCGCACACATCCTTCACCCTGTGAAGAGCGTGCGTGTGCTGCGGCCCGAGCCC
	CAGACAGCCGTGGGGCCCTCGCACCCCGCCTGGGTGGCTGCGCCCACAGCACCTGCCACTGAGAGCCTGGAGACGAAGGAGGGCAGCGCAGGCCCACACC
	CGCTGGATGTGGACTATGGCGGCTCCGAGCGCAGGTGCCCACCGCCTCCGTACCCAAAGCACTTGCTGCTGCCCAGTAAGTCTGAGCAGTACAGCGTGGA
	CCTGGACAGCCTGTGCACCAGTGTGCAGCAGAGTCTGCGAGGGGGCACTGAGCAAGACAGGAGTGACAAGAGCCACAAAGGTGCGAAGGGAGACAAAGCT
	GGCAGAGACAAAAAGCAGATTCAGACCTCCCCGGTGCCTGTCCGCAAGAATAGCAGAGATGAAGAGAAGAGAGAGTCTCGCATCAAGAGTTACTCCCCTT
	ATGCCTTCAAATTCTTCATGGAGCAACACGTGGAGAATGTCATCAAAACCTACCAGCAGAAGGTCAGCCGGAGGCTACAGCTGGAGCAGGAAATGGCCAA
	A
Exon8 58316335 - 58315753
	GCTGGGCTCTGTGAGGCCGAGCAGGAGCAGATGAGGAAGATCCTCTACCAGAAGGAGTCTAACTACAACCGGCTGAAGAGGGCCAAGATGGACAAGTCCA
	TGTTTGTGAAAATCAAGACTCTAGGCATCGGTGCCTTTGGGGAAGTGTGCCTCGCTTGTAAGCTGGACACTCACGCTCTGTACGCCATGAAGACTCTCAG
	GAAGAAGGATGTCCTGAACCGGAATCAAGTGGCCCATGTCAAGGCTGAGAGGGACATCCTGGCTGAAGCAGACAATGAGTGGGTGGTCAAACTCTACTAC
	TCCTTCCAGGACAAGGACAGCCTGTACTTTGTGATGGACTACATACCAGGCGGGGATATGATGAGCCTGCTGATCAGGATGGAGGTCTTCCCTGAGCACC
	TGGCCCGCTTCTACATTGCAGAGTTGACCCTGGCCATTGAAAGTGTCCACAAGATGGGCTTTATCCACCGGGACATCAAGCCTGACAACATACTCATCGA
	CCTGGATGGTCATATTAAGCTGACAGATTTTGGCCTCTGCACTGGATTCAGGTGGACTCACAATTCCAAGTACTACCAGAAAG
Exon9 58315139 - 58314957
	GGAACCACATGAGACAGGACAGCATGGAGCCCGGTGACCTCTGGGACGATGTTTCCAACTGTCGCTGTGGAGACAGGTTAAAGACCCTGGAGCAGAGGGC
	GCAGAAGCAGCACCAGAGGTGCCTGGCACATTCTCTTGTCGGGACACCAAATTACATCGCTCCGGAGGTGCTTCTCCGCAAAG
Exon10 58313257 - 58313151
	GGTACACGCAGCTCTGTGACTGGTGGAGCGTCGGTGTGATTCTCTTTGAGATGCTGGTTGGGCAGCCGCCTTTCTTGGCCCCCACCCCCACAGAGACGCA
	GCTGAAG
Exon11 58310607 - 58308491
	GTGATCAACTGGGAGAGCACGCTGCATATCCCTACGCAGGTGAGGCTCAGCGCTGAGGCCCGAGACCTCATCACGAAGCTGTGCTGCGCGGCTGACTGCC
	GCCTGGGCAGGGATGGGGCAGATGACCTCAAGGCACACCCGTTCTTCAACACCATCGACTTTTCCCGTGACATCCGAAAGCAGCCTGCACCCTACGTCCC
	CACCATCAGCCACCCCATGGACACCTCCAATTTTGACCCGGTGGATGAAGAAAGCCCCTGGCACGAGGCCAGCGGAGAGAGCGCCAAGGCCTGGGACACG
	CTGGCCTCCCCCAGCAGCAAGCATCCAGAGCACGCCTTCTATGAGTTCACCTTCCGCAGGTTCTTCGATGACAACGGCTATCCCTTCCGGTGCCCGAAGC
	CCTCAGAGCCCGCAGAGAGTGCAGACCCAGGGGATGCGGACTTGGAAGGTGCGGCCGAGGGCTGCCAGCCGGTGTACGTGTAAGCCTCAGTTAACCACAA
	CTCGAGGAAACCCAAAATGAGATTTCTTTTCAGAAGACAAACTCAAGCTTAGGAATCCTTCATTTTTAGTTCTGGTAAATGGGCAACAGGAAGAGTCAAC
	ATGATTTCAAATTAGCCCTCTGAGGACCTTCACTGCATTAAAACAGTATTTTTAAAAAATTAGTACAGTATGGAAAGAGCACTTATTTTGTGGATACCCA
	TCTTTTTCTTACTAAATTATAAGGACTGACTGTGAGAAACCATGCTGCTGTTATTTCCATGTGTGTTGTATCTGATAGCACTTGTCCACAGCTAGAAAAG
	GAAGAGCTGGAGAGCGTGAGGCAAGACGTCTGTGCAATAAGAGAGGATGAGGCGACGGAGCTCTGCTCAAGTCACGAGGACCGCTTATCTACACAGTGGC
	TTAGTTTTGTATTTTCCCACATTTCAAATTGTGATGTAATGTTTGAAAGCTGCTTTTGTATTTTCTCCTTTGCATATTATAGTTCCTAGAAAGAGTGAGC
	AGAGAGCTGGTGGGTGTGACTCCGGTGTCTGGTGTGGAGAGTACTGCATGAGCAGGGGTTTCTAGTATAAAATACCGTATCTTGCCATTCACAGCAGGTC
	CTGTGAATACGTTTTTAAATGAGGTATTCTAGACAGTGTGCTGATAATGTATTGTGTGGATGTGTGTTAAAGAAATGCATATGTATAACTGAAGTGTGAT
	TTTTTTTTAATGTGTGTGTGTCTTGGATATGACTGAGTTCTTCGGGAGGCAAATGTAAACATTTGTCATATATAAAACACATCAAAAGGGATTAAGTCAG
	CTTTGCCAAAACATTGACATAATTCTAGCGTTTTGTCCATTTCCGTAGTCCTGTCTGCTGTCAGGTGTGGCTGTGGGAGCTGGACCCTGCTATTCATTCT
	TTCACTCACAGGGTTCCCGCAGCCATAGGTGATGTAAGGGTCCTGCTTCCTGTGTTCTCAGCCAACCAGGAGGTTCTGTGAAACCCAGTTCTTTGGGCCT
	CTTTCACATGAGAGGTGTCTGTCACATCTCAATGTGACTTAATACGTTTTTCTAACTTTGTAAAAAGAAAAAAAGATTCTTTGAAGCAACATTGGAGTAC
	AAAAACAAGCCATACTTTTTTCTTAGACATATAGGTGTGTATATAACTATAGATAAACACACAAAATAGTCCTTATTTCAAATTAGTACGCTTCCTACTT
	AAGGTGATTTATATTTGAGTACATTCAGTTTCTTTTGCTTTTCAAGGATGGAACACATCCCATTTTCATTATGCTATGCCAAATCTTCTCACCAAGGTTC
	TTAGCACAGTGCACCCGTTACTTAGTATTATCTAGGCAGAAACACTTACAAATTTATCTATGTCTAAGAAACATTCCTGTGTCTGGTTTACATTTGTATG
	AATGGCATATTCTGAAGTCTGCTGTGCTTGTATTGTGACTTACAGTATTCTCGCTATTTTGTAGTAATGCCGTGTTATTTACAGCGCTCTGACATAGTTT
	GATGTGGTAGGTTCTTTCTCAGGAACTCAATTTAACTATTATTTATTGATATATCATTGCCTTTGAAAGCTTCTACTGGCACAATTTATTATTAAAACTT
	TAAAGCCTAGTCTCTTC
Exon12 58284267 - 58283725
	GTAGACGCACCCTTAGGAGAGCGCTTCCAAGGCTAAGAGATCCTGCTCCACACCGGACAGCCTATGGGAGCGAGAGGAAGCTCCCGCACGGGCAGGACAC
	CCAAACCTTAACCCGCAGCTAACGGGCTGCGCGGCTCCGGTCCAGGACCTCGCGGCCCGCACCCAGCAGGGAACCACGCATGCGCAGGCCCCAGACCCGC
	GCGGGATGCCCGGCCGCGGCTGACAGAGCCAACCGCTCGGCCTCGCCCGGTGCCGGCTGCCGCCGCCCTCCTCCCAGCGCCGCGACCGGGCTCACGCTTG
	TCTCCTTCCAGCTGCTCAGGAATCGGCGGTCCCGTCAGGCCGCTGGGGGCGCGACGCCGACGGCTGCTGCGACAGCCCGGGAGGCGCGAGAGGCGCCGGG
	GTCGCGGCGGCGATTGGCCGGCCGCGGCGCCTGCTCCCAGAATGCAGCGCATGGCGCGTCATTGAAGAGAGACCATGATGGCGGCGGCGCTGGGGCCCCC
	AGAAGTGATCGCTCAGCTGGAGAACGCGGCCAAAGTTCTGATG
Exon13 58267361 - 58267256
	GCACCACCTTCCATGGTCAGTAATGAGCAGCGCCAGCATGCAGAGCACATATTCCTATCATTTAGGAAGTCCAAATCACCATTTGCAGTTTGCAGGCATA
	TTTTGG
Exon14a 58262342 - 58262327
	CTGTGTTATTTTTTAG
Exon14b 58262326 - 58262172
	TTCTTCATGCTTTGGAAGTAACAGTTGAAGAGAGGTGAGGAAAGTTTGTGAAAATTGTGATCGGTGATTAGCTGCCACCTGCCTGAGGTGTCTTCTGAGA
	GGAACTAACCTCTTTGTGGTGCTAGAGCAAGGTCACTGGATTAAAACCAGATCAG
Exon15 58262060 - 58261919
	AAACCAGTAAAGTGGACTATGTCCTTTTTCAAGCTGCCACAGCTATAATGGAAGCGGTTGTCCGAGAGTGGGTTCTCTTGGAAAAGGGCAGCATCGAGTC
	ACTGAGAACATTCCTCCTCACCTATGTCTTGCAAAGGCCTAA
Exon16 58260997 - 58260616
	catttggaaggctaatgcagaaggaatgctgcaagacaaagctagactggcctgaagtatgaaattgtccctagaaactagaagaagaaaagaaaagaaa
	ggaaaagaaaagaaaagagaagagaagaaaagaaaagaaaagaaaagaaaagaaaagaaaTATCTGCTACAggagctggagagatggctcagtgattaag
	agcactagctgttctttcagaggtccagggttcaattctcagcacccatgtggcatcttacaactgtctgtagctcctgctccagggaatccagcaccct
	cacagatacacatggagtgaaaacaccaatgtacataaaataaaaatTAACTAATTAACTGAAAAAAGAGAAAAGGAAAAAg
Exon17 58257194 - 58257056
	CCTCCAAAAGTATGTTCGGGAACAGATTCTATTAGCAGTAGCAGTGATTGTAAAAAGAGGATCATTAGATAAGTCAATTGACTGCAAAAGCATATTTCAT
	GAAGTCAGCCAGTTGATAAGTAGTGGCAATCCCACTGTG
Exon18 58249169 - 58249053
	CAAACTCTGGCCTGTTCTATTCTAACTGCTCTATTGAGTGAATTTTCAAGTTCAAGTAAAACTAGCAACATTGGGCTGAGTATGGAATTCCACGGTAACT
	GCAAGCGAGTCTTTCAG
Exon19 58248347 - 58248194
	GAAGAAGACCTTCGGCAGATCTTCATGTTAACAGTTGGAGTTCTGCAGGAGTTCAGCAGACGGGAGAACCTCAGTGCTCAGATGTCCTCAGTGTTTCAGC
	GGTACCTCGCCCTCGCCAACCAAGTCCTGAGCTGGAATTTTCTCCCTCCAAATT
Exon20 58237080 - 58236968
	TGGGCAGACATTATATAGCTATGTTTGAATCCTCACAAAATGTGCTGTTGAAGCCAACAGAGTCCTGGCGGGAGGCTCTTCTGGACAGCAGAGTTATGGA
	GCTCTTCTTCACT
Exon21 58232681 - 58232524
	GTACATCGAAAAATCAGAGAAGATTCAGATATGGCACAGGATTCCCTGCAGTGCCTTGCCCAGTTAGCGTCTCTCCACGGACCCATCTTCCCCGACGAAG
	GATCCCAGGTTGATTATCTAGCACACTTCATTGAGGGCTTGCTCAACACTATTAATGG
Exon22 58232284 - 58232110
	AATTGAAATAGAAGATTCTGAAGCCGTAGGGATCTCCAGCATTATCAGCAATCTGATAACTGTGTTCCCTCGGAATGTTTTAACTGCCATCCCCAGTGAG
	CTCTTCTCCTCCTTTGTGAACTGCCTCACACACCTCACTTGTTCTTTTGGGCGAAGTGCTGCGTTGGAAGAAGTG
Exon23 58224136 - 58223960
	CTTGATAAGGATGACATGGTATACATGGAAGCATATGATAAATTGCTGGAGTCCTGGCTAACTTTGGTCCGAGATGACAAGCATTTCCATAAAGGCTTTT
	TCACACAGCATGCAGTTCAGGTGTTCAATTCCTATATTCAATGTCACCTTGCTGCTCCAGATGGCACAAGAAATTTG
Exon24 58223343 - 58223201
	ACAGCCAATGGTGTGGCCTCGCGTGAGGAAGAAGAAATAAGTGAGCTCCAAGAGGATGATCGTGATCAGTTTTCCGACCAACTAGCCAGCGTAGGAATGC
	TGGGACGGATTGCTGCCGAACACTGTATGCCTCTTCTGACAAG
Exon25 58222568 - 58222423
	TTTATTAGAAGAAAGGGTAACAAGACTCCATGGCCAGTTACAACGGCATCAGCAACAATTCCTTGCTTCACCCGGATCAAGCACCATTGACAACAAAATG
	CTTGACGATCTTTACGAGGATATTCACTGGCTTATTCTAGTTACAG
Exon26 58221503 - 58221326
	GCTACCTCTTAGCTGATGATACTCAGGGAGAGACTCCGCTAATACCTCCAGAAATAATGGAATATTCCATTAAGCATTCATCTGAAGTTGACATTAATAC
	AACACTTCAAATTTTGGGATCTCCAGGAGAAAAGGCTTCTTCCATCCCAGGGTACAGCAGAACAGATTCTGTGATTAG
Exon27 58216882 - 58216723
	GCTGTTGTCTGCTGTGCTAAGAGTCTCAGAAGTTGAATCTCGAGCAATAAGAGCAGATCTCACTCATCTACTAAGCCCTCAGATGGGCAAAGATATTGTT
	TGGTTTCTAAAACGCTGGGCCAAGACTTACCTCCTGGTAGATGAAAAACTGTATGATCAG
Exon28 58215981 - 58215812
	ATAAGTTTGCCATTGAGCACAGCATTTGGAGCGGATACAGAGGGTTCCCAGTGGATTATCGGCTACCTCTTACAAAAGGTCATCAGCAATCTGTCGGTAT
	GGAGCAGTGAACAGGACCTCGCGAATGACACTGTTCAGCTCCTTGTCACTTTGGTAGAAAGAAGAGAAAG
Exon29 58212839 - 58212665
	GGCAAACTTAGTAATTCAGTGTGAAAACTGGTGGAACCTAGCAAAGCAGTTTGCAAGCCGAAGCCCACCTCTTAACTTCCTGTCCAGTCCAGTGCAGAGG
	ACACTGATGAAGGCTCTGGTCTTAGGAGGCTTTGCACATATGGACACAGAAACCAAGCAGCAGTATTGGACTGAG
Exon30 58209916 - 58209623
	GTTCTGCAGCCTCTTCAGCAGAGGTTCCTGAGAGTGATCAACCAAGAGAACTTTCAGCAGATGTGTCAGCAGGAGGAAGTCAAGCAGGAGATCACTGCCA
	CATTGGAGGCCCTGTGTGGCATTGCTGAGGCCACCCAGATCGACAATGTAGCCATCCTTTTTAATTTTTTAATGGACTTCCTTAACAATTGCATTGGTTT
	AATGGAAGTTTACAAAAATACTCCAGAAACTGTCAATCTCATTATAGAAGTTTTTGTTGAAGTTGCACATAAACAAATATGCTATCTTGGAGAG
Exon31 58208958 - 58208778
	TCCAAAGCTATGCATTTATACGAAGCCTGCCTTACTTTGTTACAAGTGTATTCTAAGAATAACTTAGGGCGGCAAAGGATAGACGTCACGGCGGAGGAAG
	AGCAGTACCAAGACCTGCTTCTCATCATGGAGCTTCTCACTAACCTTCTCTCAAAGGAGTTCATCGACTTTAGTGACACAG
Exon32 58206908 - 58206790
	ATGAAGTGTTTAGAGGACATGAGCCAGGACAAGCAGCAGGCAGATCTGTATCGGCAGCTGATGTCGTTTTATATGGAGTAAACCTAATTCTGCCCTTAAT
	GTCACAAGATCTTTTGAAG
Exon33 58205547 - 58205417
	TTTCCAACCCTTTGTAATCAATATTACAAACTGATCACATTTATTTGTGAGATTTTTCCTGAAAAGATACCGCAGCTTCCTGAGGATCTGTTTAAGAGTC
	TGATGTACTCCCTAGAACTAGGGATGACATC
Exon34 58204821 - 58204704
	AATGAGTTCAGAAGTATGCCAGCTTTGTCTCGAGGCCTTGACACCATTAGCTGAACAATGTGCTAAAGCACAAGAAACGGATTCACCACTTTTTCTAGCA
	ACACGACACTTCCTTAAG
Exon35 58203529 - 58203437
	CTGGTTTTTGATATGCTGGTCTTGCAAAAGCACAACACGGAGATGACCACTGCAGCAGGCGAAGCATTCTACACATTGGTGTGTTTGCACCAG
Exon36 58201305 - 58199644
	GCTGAATATTCTGAACTGGTTGAGACATTACTGTCAAGTCAACAAGACCCAGTCATTTACCAGAGATTAGCAGATGCCTTCAACAAGCTCACAGCGAGCA
	GCACTCCTCCTGCCCTGGACCGGAAGCAGAAGATGGCCTTCCTAAAGAGTTTAGAAGAATTTATGGCAAATGTTGGTGGTCTCCTTTGTGTAAAATAAAC
	AAACAGAGCTATAAGCTTAACTTAGATCCTTTCTGCAAAGTGCACTGAATTGCTGAAAGTTGACTTGAGTCTTGTCCTGTTCCTCAGTTCGTTTGACCAT
	TTTGGATTTGGAAAGCCTGAGACTTTGATGTGGAGTTCCGTGAAACAGGAGAGGTCAACTTGAAATCAGCTTCGTCATTAGGTGTTAGCCATCATCTGCC
	GTATACTTGTCTTCTAGATTCTGAATGGTGATTTATATTTTTCAAAATGCAATTCCATATATGTGCAAACAGATATGGGCACCATGAAATTCATATTCAG
	TGCCTTTTCCCCTTTTGTCAAAGCATAGGTGGCTATCCAAAGTTGGTATGTTCTCGGCATTAGTTTTCAAAATGTCCATGGATCCCTCGTCATCTGAGGA
	GCTGATTGTAGGAGGGATTCTTGGGCCCTACTGTGCATCATTAGCATATTTGGTTGTTGGACTCTAGAGTAACCATTTTAATAAGCTCCTTCCTTTCATT
	ACCCTAAAAGTTTTAATTCAATACAAGAGATGCTGAAACCATGTAACAGGTTTTGTGCTTTCCAACATTTCCCCCCTTCGGTGATTATAATTACGCAGGA
	AGAAGATCCTTACAAGTGTTTGTTGGTTTCATAGTCCTCCCTCTCCCCACTTCCTCCCTTTCCTTCCCTTTCAGCCTCACTGTTGCAGGTTTTGTGTAAT
	TATTTCAGGTTTCTAATCAGACTGTGATGCCTGAACTTGAGGAAAATACGTGTATATTTTCGTTCCGTAAAGATGACTTTAGGAACTGTAGCCATTTCAT
	TGCCTTAATTTTAAGAGGAAAAGACAAACCAGATTTGTTTTAGAGAGAAATTAAGTCTTGACACTTAAGAGTTGGCTTTGGGTATTAGCTGCTATGATCC
	TCTTGCCCCTTTGATTATGTATTTATGTTTATCAGTGAGTGGAAGAGCATCCCAGCGTGGTTGTCTTTCTCAGTGTGTTTCTGTCCAGCCACACAGCCTG
	TATCTACTCTGAATGGCTTGCTTAAGCAATAACTTTTTAATGGGTGTGAATGACTAATTCACACAGACTATTGCACATTGGGGCATCAGGGGCAATAATT
	ATGCTGAAGTGGGCGCTATCCTCGTGTCACAGGAGCCACACTAACTCAATCTCAAAGACTTAAACATTTAACTTTagctaggcatggtggtgcatgcctg
	tattcctggcatttaggaagctgagtatgaaggtcaggctagtctgggttacaatgtatgatctatctttaaaaaaagaaaaAGAAAAATTCTCTTTAGA
	TCCTCTGGCTTTTCTAATCAGGATTTTTATATGCTCCCGTGCTCCTCTTAATTTTTGTGTCAGCTTTAATTATGAAAATGAAAGCTCATTTATAAACAGC
	AGGCCTCTGACACAGTCACACAGTGCAGTGGCAGCTCGAGGCCTCTGACCTAGGTGCATCTG

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+30dbEST_BI662157.1,dbEST_BB616191.1,dbEST_BU706616.1,dbEST_BU705730.1,REF_NM_015771.2,GB_AK029242.1,GB_BC053028.1,GB_AK164789.1,GB_AK029870.1,GB_AK081190.2,GB_AK029966.1,GB_AK163607.1,GB_BC024819.2,
23+2ENSMUST00000174213,GB_AK081190.2,
24+2ENSMUST00000038381,GB_AY015062.1,
45+2ENSMUST00000038381,GB_AY015062.1,
25+6dbEST_BF147719.1,dbEST_DV053902.1,dbEST_AA821553.1,ENSMUST00000077981,REF_NM_153382.1,GB_AY015061.1,
36+2ENSMUST00000174213,GB_AK081190.2,
26+24dbEST_BI412714.1,dbEST_CF727380.1,dbEST_CB246574.1,dbEST_BU055728.1,REF_NM_015771.2,GB_AK029242.1,GB_BC053028.1,GB_AK164789.1,GB_AK029870.1,GB_AK161243.1,GB_AB023958.1,GB_AK029966.1,GB_AK163607.1,GB_BC024819.2,GB_BC040025.1,
67+30dbEST_CB521560.1,dbEST_CB245308.1,dbEST_BI412714.1,dbEST_CF727380.1,REF_NM_015771.2,GB_AK029242.1,GB_BC053028.1,GB_AK164789.1,GB_AK029870.1,GB_AK161243.1,GB_AK081190.2,GB_AB023958.1,GB_AK029966.1,GB_AK163607.1,GB_BC024819.2,GB_BC040025.1,
78+23dbEST_CA980192.1,dbEST_BM950668.1,dbEST_BI331257.1,dbEST_BX511457.1,REF_NM_015771.2,GB_AK029242.1,GB_BC053028.1,GB_AK164789.1,GB_AK029870.1,GB_AK161243.1,GB_AK081190.2,GB_AB023958.1,GB_AK029966.1,GB_AK163607.1,GB_AK214001.1,
89+21dbEST_AV245313.2,dbEST_BI664597.1,dbEST_W81967.1,dbEST_CA317665.1,REF_NM_015771.2,GB_AK029242.1,GB_BC053028.1,GB_AK164789.1,GB_AK029870.1,GB_AK161243.1,GB_AK081190.2,GB_AB023958.1,GB_AK029966.1,GB_AK163607.1,
910+17dbEST_BI664597.1,dbEST_W81967.1,dbEST_CA317665.1,dbEST_BI525737.1,REF_NM_015771.2,GB_BC053028.1,GB_AK164789.1,GB_AK029870.1,GB_AK161243.1,GB_AK081190.2,GB_AB023958.1,GB_AK029966.1,GB_AK163607.1,
1011+14dbEST_BQ930443.1,dbEST_BI664597.1,dbEST_W81967.1,dbEST_CA317665.1,REF_NM_015771.2,GB_BC053028.1,GB_AK164789.1,GB_AK029870.1,GB_AK161243.1,GB_AK081190.2,GB_AB023958.1,GB_AK029966.1,
1213+43dbEST_CN528975.1,dbEST_AA620183.1,dbEST_AI607237.1,dbEST_BY722572.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,GB_AK084907.1,GB_AK163516.1,GB_AK163558.1,GB_AK021022.1,
913+3dbEST_AV245313.2,ENSMUST00000174694,GB_AK029242.1,
1214a+1ENSMUST00000174424,
1314b+11dbEST_BB659770.1,dbEST_CJ060488.1,dbEST_CJ059701.1,dbEST_BB645234.1,GB_AK084907.1,GB_AK163558.1,GB_AK021022.1,
1315+32dbEST_CN528975.1,dbEST_CN675968.1,dbEST_BY722572.1,dbEST_CN678293.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,GB_AK163516.1,GB_AK029242.1,
14b15+11dbEST_BB659770.1,dbEST_CJ060488.1,dbEST_BB645234.1,dbEST_CJ130256.1,GB_AK084907.1,GB_AK163558.1,GB_AK021022.1,
1516+10dbEST_BU052924.1,dbEST_BB645212.1,dbEST_CJ060665.1,dbEST_AV245313.2,GB_AK021022.1,GB_AK029242.1,
1517+23dbEST_CK636572.1,dbEST_CN528975.1,dbEST_CN675968.1,dbEST_AU022767.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,GB_AK084907.1,
1518+1ENSMUST00000174424,
1718+25dbEST_CF172146.1,dbEST_CO045687.1,dbEST_CK636572.1,dbEST_CN528975.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,GB_AK084907.1,
1819+21dbEST_CN530988.1,dbEST_CF172146.1,dbEST_CO045687.1,dbEST_CK636572.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,GB_AK084907.1,
1920+16dbEST_CN530988.1,dbEST_BG977046.1,dbEST_CF172146.1,dbEST_CO045687.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,GB_AK084907.1,
2021+18dbEST_CK781576.1,dbEST_CN530988.1,dbEST_CA568232.1,dbEST_BG977046.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,GB_AK084907.1,
2122+14dbEST_CK781576.1,dbEST_CN530988.1,dbEST_CA568232.1,dbEST_BG977046.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,GB_AK084907.1,
2223+14dbEST_AV459791.1,dbEST_CK781576.1,dbEST_CN530988.1,dbEST_CA568232.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,GB_AK084907.1,
2324+13dbEST_AV479257.1,dbEST_AI614944.1,dbEST_AA068446.1,dbEST_AV459791.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,GB_AK084907.1,
2425+13dbEST_BB482129.2,dbEST_BG806760.1,dbEST_AV479257.1,dbEST_AI614944.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,GB_AK084907.1,
2526+15dbEST_BM227256.2,dbEST_BB482129.2,dbEST_CB842464.2,dbEST_BG806760.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,GB_AK084907.1,
2627+14dbEST_AV450032.1,dbEST_BM227256.2,dbEST_BB482129.2,dbEST_CB842464.2,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,GB_AK084907.1,
2728+15dbEST_CN678564.1,dbEST_AV450032.1,dbEST_BM227256.2,dbEST_BB482129.2,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,GB_AK084907.1,
2829+14dbEST_CN528728.1,dbEST_CF163587.1,dbEST_BE376393.1,dbEST_CN678564.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,
2930+14dbEST_CV560190.1,dbEST_CN528728.1,dbEST_AV506174.1,dbEST_CF163587.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,
3031+13dbEST_CF537524.1,dbEST_CN536351.1,dbEST_CA561640.1,dbEST_CN687993.1,REF_NM_020506.1,GB_AK129430.1,GB_AF145021.1,GB_BC156636.1,
3132+15dbEST_CF537524.1,dbEST_CN536351.1,dbEST_CA561640.1,dbEST_CN687993.1,REF_NM_020506.1,GB_AK129430.1,GB_AK042783.1,GB_AF145021.1,GB_BC156636.1,
3233+15dbEST_BM230095.2,dbEST_CF537524.1,dbEST_CN536351.1,dbEST_CA561640.1,REF_NM_020506.1,GB_AK129430.1,GB_AK042783.1,GB_AF145021.1,GB_BC156636.1,
3334+16dbEST_BG870219.1,dbEST_CB231857.1,dbEST_BM226996.2,dbEST_BM230095.2,REF_NM_020506.1,GB_AK129430.1,GB_AK042783.1,GB_AF145021.1,GB_BC156636.1,
3435+19dbEST_BG870219.1,dbEST_CN534777.1,dbEST_CN535817.1,dbEST_CN535001.1,REF_NM_020506.1,GB_AK129430.1,GB_AK042783.1,GB_AF145021.1,GB_BC156636.1,
3536+22dbEST_BG870219.1,dbEST_CN534777.1,dbEST_CN535817.1,dbEST_BG077897.2,REF_NM_020506.1,GB_AK129430.1,GB_AK042783.1,GB_AF145021.1,GB_BC156636.1,