NIA Mouse Gene Index (mm92)

Exon structure for U035782

chr14 -

Exon1 76510623 - 76510424
	GGAAAAACCTTCGGGCCTTGCAGCAAATCCTGGTCTACACCGTCCAGCCTGGGTTTAGCTAAACTGCGTGTGCAGGTTGGCTTGGGCTTTGAGCGACTGT
	GCGTCGCAGCGAATGGCTAGGGACCTGATCGGGCCGGCACTGCCGCCAGGCTTCAAGGAGCACGCGACAGTTGAGGACGAGGAACGGGACCCGAGCCCGG
Exon2 76507260 - 76507128
	TTGCAGGGCCAGCTCTGCCCCCTAATTACAGAAGCTGCAGTTCAGACTCCTCAGACAGTGACGAGGACAGTAGTTCTTTATCTGAAGAAGGCAATCAAGA
	GTCTGAAGAAGAGGACACTGGTCCAAATGCAAA
Exon3 76505959 - 76505861
	AAAGCAGAGGCGAAATCAAGATGATGATGACGATGATGATGGGTTTTTTGGACCAGCCCTTCCTCCTGGGTTTAAGAAGCAGGATGACTCTCCTCCCAG
Exon4 76502358 - 76502253
	GCCTATAATAGGTCCCGCATTGCCACCTGGTTTCATTAAGTCTCCACAGAAAAATGACAAAGGCAGAGAGGATCCAGGGCAAGTGTCATCATTCTTCAAC
	TCAGAG
Exon5 76498998 - 76498867
	GAAGCAGAGAGCGGTGAAGATGAGGATATTGTTGGACCAATGCCTGCAAAAGGACCAGTTAACTATAGCGTCACGACAGAGTTTGAAAAAAGGGCCCAGA
	GGATGAAGGAAAAATTGACCAAAGGAGATGAT
Exon6 76498425 - 76498261
	GATTCATCTAAACCAATTACAAGAGAGTCCTGGATGACTGAGCTTCCACCAGAAATGAAAGAATTTGGTCTGGGGCCAAGAACCTTTAAGAGAAGAGCAG
	ATGACAAATCCGGAGACCGATCCGTCTGGACAGACACCCCAGCTGACCGGGAGAGGAAAGCTAAG
Exon7 76494912 - 76494814
	GAAATACAAGAAGCAAGGAAGTCATTCAGTAAGAAAGATGAAGAAAACATATTGTCAGGAAGGGATAAGAGACTGGCCGAGCAAGTATCCTCATACAAT
Exon8 76490553 - 76486039
	GAATCAAAAAGATCAGAATCCCTCATGGACATTCATCATAAGAAGTTAAAGAGTAAGGCTGCTGAAGATAAAAACAAGCACCAGGAGAGAATACCATTTG
	ACCGTGATAAAGATCTCAAGGTTAATCGGTTTGATGAGGCTCAGAAAAAAGCCCTAATAAAGAAATCCAGAGAACTAAACACCCGGTTTTCACATGGCAA
	AGGCAACATGTTTTTATAAGTAAGTGTACTTCAGTGAGGTACACTTATACTGATCAGCCTGAACCCCTCAGAATATACCTTTGTCAATAGTAATTATGTG
	CACAAATACGTCTCCTTTTGTATAAAGTAGATTCAGGGTCTACATTTTTATAAATTGTGACTTTTGAAAAGTTGGGGGAGGGGAGATAGTGGGAAAAAAA
	AGCTTTGTCTTCACAATAGCCCAACAGAACATTGCTACTAGAAAAGGGTTTCAATGAAGAGAAAGGGCTCTTCACAGAGTGTGGTGTGCAGCTTGAGGGG
	TCATGTGGTCCATTAGGGGCATTTGTGTGTGTTTAATTGTTCACTTGCttgttgatttttgagacggggtctcactgtgtaaccttggctggcccagaac
	tcactgtgtatactactagcaagctggcctcaaactcccagagacccacctgcctctgtccccaagtgctgggattaaaggtgagtgccaccataccGTT
	CTTTGAACAACATTACAGTTAGAAAAACATGCATTGCTCCAGAAGGCCTCTGTAAGTTGAGTGTCAGCTGGTACGCCTTAAATATCCATAATCCCATGGG
	TCCATCTATGAGAGTCTGGGATGTTGGTTAAGGAATTGTGTGAGAGCTGAGGATGCTTCTTAAGTTCCTCGTGATTTGTAGTATCATGAAATAGATATCG
	ATATTCAGGTGTGATTTTAAAGGATAATATGAACTTTAAAATGTTTTTCAGCTTACTGCATTGTTACATAAGAGAGATTTCCCCGTGTGATGTTTGTCTG
	GCCACCATAATTTGTTAGAGAATGATCTTTAAAAACATATAAATTTGCCATGGTCTGTATCCTTTAAAGTACTATGGGGACAGACAATCTGTGTTCTTAT
	ATAGAATGGAATGATTTTGGGTGTTCTTGGCTTTTCTTCATGTAATTATTTTAAGAGTCCATCCCCACAATACTACAGCCCCTAATTTTTTATGGTGTCT
	TACATGTTTCCTTAGTTCTGGGTGAGACTGTATACTCTCTACCACAGTCTGGACATTTTTCTTCAAATATATTTAACCTGCCCTAGAATCATTGTGTCAG
	GCtgtcttagttagggttttacctctgtgaacagataccatgaccgaggcaactcttgtgaggacatttaattagggctggcttacaggttcagaggttc
	agtccattagcatcagggtgggagcatggcagcatctagacaggcatggtgcaggaggagcagagagttcaacatcttcatctgaaggctgctagcagaa
	tactgttaggatgagggtcttaaaactcacacccacagtgacacacctactccaacaggccacaccttctaatagtgccactctctgggccaagcacata
	caaaccatcacaCAGGCCCTTGCAAATCCATCAATTTTAAATTTCTTAGCTTGTCTTCCAAACTGAACCTAGTCTATACAGAGCATGGGGGTTTGTCCTT
	CCTGCTGTTGTATTTATTTAGTTCCTGTCAGGTTAATTGTTTTTATTGGTTTTAAGGTAAAGAAGCTGTTTGGATTATCTCAGGTTAAGGAAATATTGTG
	ATTTTAACAGTAAATATTTGTAGGGGAGGCAATCTGAAGGACATTATACTCACCTATTCTCATTCATGTGAAGTCTAGGATGCTGTCTTCATGGTCTCAC
	CAAAGCTGCCTGCATCTTGGAACGTCACATGTGATCATCTGATTCATATATGTATATAGCACTTTGTATCTGGTTTACTGGAATATTAATTCTGGATGGC
	TTTTAAAAATAACCAAATAATCACTGGAAATGGGGAATCTGTACTCGCAACCACCCAGTGGGAGTATTATATGGTTTAGTGCTGTAAGCAATGCCTCTTG
	AGCTGTTAAACAGACACTCCTAATGAGGGAGAGAAAAGCTAAATGCGAATTCTGGGCATTTCTAGCAGGTTTTTTTGTTCTGCCGACTCTGTATTCTAGT
	TTTCACAAAGCATAGAGTTGTAATGGGAAAATGTTTTGATTCCCAATTCATGTGAACTTTATAAAAATTAGGCAAACTGTTCAAATTACAATATAAAGTA
	TTTCTTAATAGTGGCACAATTTTTATACTGGTATAAACAGCCTATTCAAGGACTGCTGCTTCTTAAAACCTGAATTATTTTGAGTAAATTAAACAGACTT
	CTTGTCCCCATAGATTTAGATAGATCTACCCTTTGGCTAAAGTGAATGGGTTTCTGCATATAAAACTTTATACAAGAGTATTAATTCTGACTAgcatggt
	catgagtgcctttaatcccagcacttggaaggcagaggcaggcatatctatgtaagctcaaggccagcctgctctacagagtgaattccaggacatccag
	tgctgtgtagagagaccctgtctcaaaaaTCCAAGAAAAAGGAGTATTTATTCTGTCCTTTTCATATTGTGATTATCCCCCCCCCCATGAGAGGAAAATG
	TTTTTTTAGCTATTAGAAAACCTAACATATTTTGTGAAATTTGTTACTTTTAAAAGttattatgtgtaagtacactgtagctgtcttcagacactccaga
	agagggtatcagatttccttacggatggttgtgagccacaatgtggttgctgggatttgaactcaggacctttggaagagcagtcggtgttcttaactgc
	tgagccatttctccagcctcTTTTTAAAGTTAAAATACTAAGAAATCAATCAATTTAAAGGAGGTAGCTGTCGGCagagcgtgtacagctcttgcaaatc
	acctgactcagttcccagcacccacacctggtgtccacactccctgtaactccagctgcacggggtctgacccctcttggggtccatggtcatctgtgcc
	catgtacaaaatgacactcagactcataactttaaaaataatcttaaaagtaaaAATACCACTTCTGGACACTCATTGGCCTTGCTTTCTCAGTGGAAGG
	GGTTAGGAATATCTGTACTATGCTTACTATTTCCTGTGACCTCAGATAAAGGACAGCCCACCAGATGTATGATTACCTCGCTGGCACCCTGGAGCCAGTG
	CTATTTTCTGTTACCCAGATGACAGTTGCAGTAAAGTATATGCCATTTCCAGGGAGGTTTGGCCACATGGAGACATAAATCTCAATTAATATTGACCATA
	AAAAAATGAAGCAGCTCTGTGTGCATTACAGAAAGATGTTCCTCATATCATCCCATCTTCCAAAGAGCAGAGGCCTGCTGGAGTCCACTGCCCTGACAGT
	CAGCATTTCCTAATAAAAGCAGCCCTGCAACCCCTGGCCATGTTTTACAGGGAGTGAAGAAGAAAGGAGTTACTAGCACCAGGTCAAACCCTGGTGTCTC
	ACCACTAACGTTGGCCATCAATTCCCTGGATGGCCTTGTCCAGGTCCGACTGCTCAGCCTCAAACAGTATTCACATCACTGGTGAGCAGACGGTTGGTTT
	TAGTAGTAGGGGAAGATGAGGGACTAAAACAAGAGAGGACCTGGCCAACCCAGGATAAGACTTTCAGATTGGCCTCCACAGGGAAAACTGAGCTCTGCTT
	GTGGGGTGGGGGACATAGTCTACATGAGTTTTTTCATTTATTTAGCTTTAAGAACACATTCACTTATTCATTTATCCTTTGTTAGGTGTGAGATTGCTAT
	GTGTATAGATCTGAGCCTTCCATGTTTCAGAGTCACATAAATCATTCGCTGTTACATGATACTATGGTTCTTATGCAGACTAATCATGTTGATACCATTG
	TGAAATACATGACAGTGGTGCAGAGCTCATAAGCTCGAGGCCTCGTCCGCTTCCACTTCTCCATGGTGTTATTGGTGCTTCTAGAAAAGCCTCTCCAGGG
	CATTATACCTGAGAGGAGGAGTCTACATCGAGGAAAGTGGCTCCAGATGAGAGACCACGAAGCACCACCTACCTGACTTCTGCTGCCATACTGAGGCTTC
	GTCTGGGCTGCAGATACAGAGCCTTGTGCTGCTGTAGAAGAGCTTTTTGTTTGGTTGTTGTTGTTTTGTTTACAGCTTTAAAAACCCACTCTAACGGGGC
	CCAGGCATGTGGGTGAGCGTGAAGTCCTGGCTCCATCCCCAGTTCTCAGCACCACCCAGAAATTGTTTAACTGTGACCATGGTGTGTACAAGGTTGAAAG
	GTTGTATACTCCTTGTAGCCGTTTCATTTAGGAAAGGCTGCTTTTAGAAAAGGATCATTTTGAAGTATAGTTTTATATATACATATATGAATAAAATGTC
	CTCTATATCTGAGAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+32dbEST_CX240101.1,dbEST_BI905480.1,dbEST_CK637421.1,dbEST_CN535975.1,REF_NM_026177.3,GB_AK173238.1,GB_BC029731.1,GB_AK004707.1,GB_AK082912.1,GB_AK016681.1,
23+29dbEST_CB527425.1,dbEST_CX240101.1,dbEST_BI905480.1,dbEST_CK637421.1,REF_NM_026177.3,GB_AK173238.1,GB_BC029731.1,GB_AK004707.1,GB_AK082912.1,GB_AK016681.1,
34+27dbEST_CD804547.1,dbEST_CB527425.1,dbEST_CV674895.1,dbEST_CF540603.1,REF_NM_026177.3,GB_AK173238.1,GB_BC029731.1,GB_AK004707.1,GB_AK082912.1,GB_AK016681.1,
45+24dbEST_CV556470.1,dbEST_CA324662.1,dbEST_CD804547.1,dbEST_CB527425.1,REF_NM_026177.3,GB_AK173238.1,GB_BC029731.1,GB_AK004707.1,GB_AK082912.1,GB_AK016681.1,
56+25dbEST_CV556470.1,dbEST_CB723792.1,dbEST_BB621968.1,dbEST_CF906025.1,REF_NM_026177.3,GB_AK173238.1,GB_BC029731.1,GB_AK004707.1,GB_AK082912.1,GB_AK016681.1,
67+20dbEST_CD803752.1,dbEST_CV556470.1,dbEST_CB723792.1,dbEST_BB621968.1,REF_NM_026177.3,GB_AK173238.1,GB_BC029731.1,GB_AK004707.1,GB_AK082912.1,GB_AK016681.1,
78+19dbEST_CA983682.1,dbEST_CD803752.1,dbEST_CV556470.1,dbEST_CB723792.1,REF_NM_026177.3,GB_AK173238.1,GB_BC029731.1,GB_AK004707.1,GB_AK082912.1,GB_AK016681.1,