NIA Mouse Gene Index (mm92)

Exon structure for U035812

chr14 -

Exon1a 80171119 - 80168595
	AGCTCCAGCCCAGGGAAAGGAGGCGGAGGCGCCGAGTGAGGGTGGGTCTGCGCGTCCTCCGAGCCAGCCCGAGCCGGAGCTGCAGCTTTTCCCGCACGGG
	GCTCGCAGAGCCTGGGACTCACGCTCCGATCTGCACGCCGGGGAAGACTCTTTAGGTTAGCCTTTCGGAATAGCAGTTGGGGATTGGCGATATGAGTCCT
	GCGAAGCGCTGGGGCAGCCCTTGCCTTTTCCCCTTGCAGCTATTTAGTCTCTGCTGGGTGCTCTCAGTGGCCCAGAGCAAGACAGTCCGATACAGCACGT
	TCGAAGAGGATGCCCCTGGCACAGTCATCGGAACCCTTGCAGAAGACCTGCACATGAAAGTGTCTGGAGACACAAGCTTCCGCCTGATGAAGCAATTCAA
	CAGCTCTCTGCTCCGGGTACGCGAGGGCGACGGGCAGCTGACCGTCGGGGATGCGGGCCTGGACCGTGAGCGTCTGTGTGGCCCGTCCCCACAGTGCGTG
	CTGGCCTTCGATGTTGTCAGCTTCTCGCAGGAACAGTTCCGCCTGGTGCACGTGGAGGTGGAGGTGAGGGATGTAAACGACCACGCGCCCCGCTTTCCCC
	GAGCCCAGATCCCGGTGGAGGTCTCAGAGAGCGCTCCGGTAGGCACACGCATCCCCCTGGAGGTGCCCGTGGACGAGGACGTGGGTGCCAACGGGCTGCA
	GAGTGTACGCCTAGCCGAGCCTCACAGCCCCTTCCGCGTGGAGCTGCAGACGCGCGCGGACGGTGCCCAGTGTGCGGACCTGGTGCTGCTACAGGAGTTG
	GACCGCGAGAGCCAGGCCTCCTACAGCCTGGAGCTGGTGGCTCAGGATGGCGGGCGACCGCCGCGTTCCGCCACAGCAGCCCTCAGCGTGCGTGTGCTAG
	ATGCCAATGACCACAGCCCGGCCTTCCCACAGGGTGCCGTGGCAGAGGTGGAATTGGCCGAGGACGCACCTGTGGGATCGCTGCTGCTCGACCTGGACGC
	TGCCGATCCCGACGAAGGTCCCAACGGCGACGTTGTGTTCACCTTCGGCGCCCGCACCCCTCCCGAAGCCCGCCACCTCTTCCGGCTCGACCCGCGCTCT
	GGCCGCCTCACCTTGGCTGGGCAGGTGGACTACGAGCGCCAGGACACCTACGAGCTGGACGTGCGGGCTCAAGACCGAGGTCCAGGGCCCCGGACAGCCA
	CCTGCAAGGTTATCGTGCGCATCCGAGACGTCAACGACAACGCTCCTGAAATTTCTATCACTCCTCTGGCCGCCCCGGGGGCTCCAGCCACCTCGCCCTT
	cgccgccgccgccgctgccgccgcACTCGGAGGAGCGGACGCGGCCTCGTCGACTGGGTCCGGGACACAGGAAGCCGGTATCACCTCGCTGGTGCCAGAG
	GGGGCGGCGCGCGAGAGTCTAGTGGCGCTGGTCAGCACCTCGGACAGGGACTCGGGCGCCAACGGGCAGGTGCGCTGCGCCCTCTACGGGCACGAGCACT
	TTAGGCTGCAGCCGGCCTATGCTGGCAGCTACCTGGTGGTGACCGCTGCATCTCTGGACCGGGAGCGCATCGCGGAGTACAACCTGACGCTGGTGGCCGA
	AGACCGTGGCACACCCCCTCTTCGCACCGTCAGGCCCTACACCGTGCGAGTGGGGGACGAGAACGACAACGCACCGATCTTCACCAAGCCAGTCTATGAG
	GTGTCGGTCCGCGAAAACAACCCTCCAGGCGCCTACCTGGCCACAGTGGCAGCCCGCGACCCTGACGTGGGTCGCAACGGTCAAGTCACCTACCGCCTGG
	TAGAGGCCGAAGTGGGCCGCTCTGGGGAAGCCGTGTCCACTTACGTCTCAGTAGACCCGGCTACCGGAGCCATCTACGCTCTCCGTAGTTTTGACTATGA
	GACTCTGCGCCAGCTTGACGTGCGTGTCCAGGCCAGCGACGGCGGTTCCCCTCAGCTTTCCAGCAATGCTCTGGTGCAAGTGCGGGTGCTGGACCAGAAT
	GATCATTCTCCGATCCTTGTGCATCCGGCGCCGGCTAATGGCTCCCTAGAAGTAGCGGTCCCTGGACGTTCCACCAAGGACACAGCTGTGGCGCGCATCC
	AGGCCCGGGATGCTGACGAAGGAGCCAACGGGGAACTGGCCTTTGATCTGCTGCAGCAGGAGCCACGCGAGGCCTTCTCCATAGGCCGCCACACGGGGGA
	GATCATGCTTACTGGAGACCTCTCGCAGGAGCCTCCTGGCCGCGTGTTCAAGGCCCTGCTGGTCATATCCGACGGCGGCCGTCCCCCTCTCACCACCACT
	GCAACCGTCAGTTTCGTGGTAACAGCCGGGGGCGGGTCAGCTGTGCCTGCCAGCTCCGGGAGCCCAGAGCACTCCCGGCCACCCGGCTCTCGCCTCGCGC
	CGTCGGGGCCTTCGCTGCAGTGGGACACGCCGCTGATCGTCATCATCGTGTTAGCCGGGAGCTGCACGCTGCTGCTTGCAGCCATCATCGCCATCGCCAC
	CACCTGCAACCGCCGCAAGAAGGAG
Exon1b 80168594 - 80168304
	GTGCGCAAAGGGGGGGCCCTCCGGGAAGAgcggcccggggcggcgggcggcggAGCCTCGGCCCCTGGCTCCCCGGATGAAACCGCCAGGGGAACTGGGC
	CCAGGCCCAACATGTTCGACGTGCTCACCTTCCCTGGCAGCGGCAAAGCGCCCTTTGGCAgccccgcggccgacgcgcccccgcccgcggtcgccgcggc
	cgAAGTGCCGGGCTCGGAGGGCGGCAGCGCCACTGGGGAAAGCGCCTGTCACTTCGAGGGGCAGCAGCGGCTCCGAGGCGCGCACGCCGAG
Exon2 80168128 - 80167918
	CCTTACGGTGCCTCTCCAGGCTTCGGGAAGGAGCCTGCTGCGCCCCCTGTTGCAGTCTGGAAGGGTCATTCATTCAACACCATCTCGGGCCGAGAAGCTG
	AGAAGTTCAGTGGGAAAGACAGCGGCAAAGGAGACAGTGATTTCAATGACAGTGACTCGGACATCAGCGGGGACGCTTTGAAAAAAGACCTCATCAACCA
	CATGCAGAGTG
Exon3 80167554 - 80166579
	GACTGTGGGCGTGTACTGCTGAGTGCAAGATCCTAGGTCATTCTGATCGCTGCTGGAGCCCATCCTGTGCCGGACCCAACGTACACCCCCCTCCTCACCC
	ACCAGCCCAGATGTCAACCTTCTGTAAGAGCACGTCCCTGCCTCGGGATCCTCTGCGCAGGGACAATTACTATCAGGCCCAGCTCCCCAAGACAGTAGGG
	TTGCAGAGCGTCTATGAGAAAGTACTGCATAGAGACTATGACAGGACAGTCACTTTACTCTCCCCTCCCCGTCCAGGAAGGCTCCCAGACCTGCAGGAGA
	TTGGAGTACCCCTCTATGAATCCCCTCCTGGTAGCAGATACGTGTCCCCGAAGAAGGGAATCAATGAAAATGTGTAATCTTATCCTGCATGTCTTCACAC
	ACATATACAGGTCACCCTGACACGTCCCTAAGTTATTGACCGGTTTCAGTGTTGTATATATAAATATGCAAGATGTGCCTTAAAATGAAGTTGTTGGAAG
	CTATTTCCAATCACATTGGTACTGTTTGGTATTTGCAAACAAAAAAAATGTAGTTAATGTAATTTTTATGAAATGTGTGCAGTATTTAATTTTTCTTATC
	ATGCTATTGGCTTTAATTTCATTTGTGGCTTGCAATTTTCTTAGTGTTTTTAACCTGTACATTGTGTAATGTAATGTTTGTATATACTGaaattttgtta
	tatttttatatattaaaaGCTAAGTGGAAGTTACTGCCAAAGGAATTGTCTGTAAGACAAAAAACAAAATGTGTTGGAATTGCTCATTGGGATTTTATCT
	TTCACCAGAAACAACCTAATGTTTGAGAAGTTTTTGCCTTGCCAAGTCTAACAACTTGTAGATCTTGAGTCTGTGGTAGATTTCAAGTTACTGTTATTTA
	ATTACATTCGGTTCTCTGTAAGCTCTGTCACTTATAAGCACAGTAATAAAGGATTCGTCATGTATTTGAAGAATCT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1a2+3REF_NM_001042726.3,GB_AK140407.1,GB_AK048638.1,
1b2+4ENSMUST00000039568,REF_NM_021543.4,GB_BC053008.1,GB_AF231125.1,
23+8dbEST_AV583724.1,ENSMUST00000039568,REF_NM_001042726.3,REF_NM_021543.4,GB_AK140407.1,GB_BC053008.1,GB_AF231125.1,GB_AK048638.1,