NIA Mouse Gene Index (mm92)

Exon structure for U036080

chr15 -

Exon1 34425010 - 34424808
	GGGCCGTGCGAATTCGCACGGGGCTGTCCCTGAACTAAAACTCTTTTGCCTAGGGCTGTCTGGTCAGTGGACAAGAGTGGGTGTAGTTACTTACCATCGT
	TTCTTCTTCTGGAGGGTCTTCAAGAGGGAAGGATTAGCATGTCGTCCATAATCAGAAAGGTGATCAGCACCACAAAAGCCCCGGCGGCCATTGGTCCCTA
	CAG
Exon2 34419555 - 34419387
	GTCAGAGCCGACCTCCAGCACTTCCTGTGTAAGGGATGAGCATACACCAGGATAGGGTGATAAGGGGACAGGAAGGAGGTTTCCTCTGGAGCCAAGGGGA
	ATAGGACTGCTGGCTTTCGATTCTTTGGTGGTTCCGTCTCCTGAACCTGCAAAATCACCagtatgggag
Exon3 34418434 - 34418329
	TCAAGCTGTGCAAGTGGACAGGACCATTTACATTTCTGGACAGGTAGGCCTGGATCCTTCCAGTGGACAGCTTGTGCCAGGAGGAGTAGTAGAAGAAGCT
	AAACAG
Exon4 34417551 - 34417497
	GCTCTTAAAAACTTGGGTGAGATTCTGAAAGCTGCAGGCTGTGACTTCAATAATG
Exon5 34416434 - 34416366
	TGGTGAAAACAACTGTTTTACTGGCTGACATGAATGACTTTGGCACTGTCAATGAGATCTATAAAACAT
Exon6 34415410 - 34415355
	ATTTCCAGGGTAGCCTTCCTGCCAGGGCTGCTTACCAAGTCGCTGCTTTACCCAGA
Exon7 34414290 - 34413772
	GGAAGTCGAGTTGAAATCGAAGCAATCGCTGTCCAGGGGCCTTTCATCAAGGCATGACTATAAGTAGCCATGCTGATGTTGACTCCGGAGGTTTTAGAAT
	GTCTTTCACACTTTAATTTTTACAAATGATGCTGGGAAGTATAAAAATGACCAGAGTGGTTGAAGTTATTGTGGAAGTGATCAAATATGTGGAGATTTGA
	CATTAATTGGAGATTATTCAGTATAGTGACTGATGTTCTAATTTCACTTATGTTGCTGGGTGTGAGAGAAGAGGTGCACAGCTACTGAGATGGGAAGCAG
	AAGGAAAGATGGGCTGTTGTACATGAGAAATAGTAAGGAGCACATCTACTTAAATCATATTAATTTGCTCATGTGAAATACTTAGTTCTTATGTTAGATA
	TAAGAAACTAAATTGAAATATTCAAACTTGAATAGTACCAGGAGAACAAGTGGACCAAAATCTTATACAGATAATATTACTTTAATTGAAATAAAAAATA
	GATGTGTAACTTTCCCTTG

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+101dbEST_AA445560.1,dbEST_AA105855.1,dbEST_AA068013.1,dbEST_AA244677.1,REF_NM_008287.3,GB_BC092375.1,GB_BC125590.1,GB_BC125592.1,
23+5dbEST_AI787157.1,dbEST_BY705224.1,ENSMUST00000125286,ENSMUST00000129426,GB_AK005016.2,
34+112dbEST_AA445560.1,dbEST_AA105855.1,dbEST_AA068013.1,dbEST_AA244677.1,REF_NM_008287.3,GB_BC092375.1,GB_AK005016.2,GB_BC125590.1,GB_BC125592.1,
45+111dbEST_AA445560.1,dbEST_AA839848.1,dbEST_AA105855.1,dbEST_AA068013.1,REF_NM_008287.3,GB_BC092375.1,GB_AK005016.2,GB_BC125590.1,GB_BC125592.1,
46+0
56+102dbEST_AA238206.1,dbEST_AA238158.1,dbEST_AA864005.1,dbEST_AA445560.1,REF_NM_008287.3,GB_BC092375.1,GB_BC125590.1,GB_BC125592.1,
67+100dbEST_AA238206.1,dbEST_AA238158.1,dbEST_AA864005.1,dbEST_AA445560.1,REF_NM_008287.3,GB_BC092375.1,GB_BC125590.1,GB_BC125592.1,