NIA Mouse Gene Index (mm92)

Exon structure for U036679

chr15 -

Exon1 101321943 - 101321518
	ACACGGCCTCAGTTCCAAACACTGTCAACTTCTCTCCTCTTCGCGCGTGTCTTCTCCTCCACCATGACCTGTGGCTTTCGAACTGGAAACTTCAGCTGCG
	CCTCAGCCTGCGGGCCCCGGCCTGGCCGCTGCTGCATCTCTGCAGCTCCCTACAGGGGCATCTCCTGCTACCGAGGACTCTCAGGGGGCTTCGGCAGCCA
	GAGTGTCTGTGGGGCCTTCCGCTCCGGCTCCTGTGGACGCAGCTTCGGGTACCGATCTGGAGGCATCTGCGGGCCCAGCCCACCCTGCATCACCACCGTC
	TCTGTCAATGAGAGCCTGCTCACACCCCTGAACCTGGAGATCGACCCCAATGCTCAGTGTGTGAAGCATGAGGAGAAAGAGCAGATCAAGTGTCTCAACA
	GCAGGTTCGCGGCCTTCATCGACAAG
Exon2 101320223 - 101320015
	GTGCGCTTCCTGGAGCAGCAGAACAAGCTGCTGGAGACCAAGTGGCAGTTCTACCAGAACCGCAAGTGCTGTGAGAGCAACATGGAGCCTCTGTTCGAGG
	GCTACATCGAGACGCTGAGGCGGGAGGCTGAGTGTGTGGAGGCCGACAGCGGGAGGCTGGCTGCTGAGCTCAACCATGCGCAGGAGTCCATGGAGGGCTA
	CAAGAAGAG
Exon3 101318863 - 101318803
	GTATGAAGAAGAAGTTGCACTCCGGGCCACAGCAGAGAATGAGTTTGTGGCTCTAAAGAAG
Exon4 101318676 - 101318581
	GATGTGGACTGTGCCTACCTGCGCAAGTCAGATCTGGAGGCCAACGCAGAGGCTCTGACCCAAGAGACCGACTTCCTGAGGAGAATGTATGATGAG
Exon5 101318414 - 101318250
	GAGACCCGCATCCTCCATTCCCACATCTCAGACACATCTGTCATCGTCAAGATGGACAACAGCCGGGACCTGAACATGGACTGTGTCGTGGCTGAGATCA
	AGGCTCAGTATGATGACATTGCCAGCCGCAGCCGTGCTGAGGCCGAGTCCTGGTACCGCACCAAG
Exon6a 101318026 - 101317901
	TGTGAGGAGATGAAGGCCACAGTGATCCGGCATGGAGAGACTCTGCGCCGCACCAGAGAGGAGATCAATGAGCTGAACAGAATGATCCAGAGGCTGACTG
	CTGAGATCGAGAATGCCAAGTGCCAG
Exon6b 101317900 - 101317892
	GTATGTAAG
Exon7 101317624 - 101317404
	AACACCAAGCTGGAGGCTGCTGTGACCCAATCTGAGCAGCAGGGAGAGGCTGCCCTTGCTGATGCCCGCTGCAAGCTGGCTGAGTTGGAGGGTGCCCTGC
	AGAAGGCTAAGCAGGACATGGCCTGCCTGCTCAAGGAGTACCAGGAGGTGATGAACTCCAAGCTGGGGCTGGACGTGGAGATCATCACCTACAGGCGCCT
	GCTGGAGGGCGAGGAGCAGAG
Exon8 101316444 - 101316413
	GCTGTGTGAAGGCGTGGGAGCTGTGAATGTCT
Exon9 101316135 - 101316027
	GCCTCCTGGCTCCCAAGAGGAGGCTCCTCTACACAGCTTGCAAACTAAAACTGAGACTTTATTGTAGCATTCCTCAGAGGGCTGGAGCAAACGAATGGAC
	CAAGGGAAG
Exon10 101315981 - 101315561
	GTGTCAGCAGCTCCCGTGGTGGAGTTGTGTGCGGGGACCTCTGTGTGTCTGGCTCACGGCCTGTGACAGGCAGTGTCTGCAGTGCCCCATGCAGCGGGAA
	TGTGGCAGTAAGCACTGGCCTGTGTGCGCCCTGTGGAAGCGGCCCTTGTCACCCGGGGAGGTGTTAGGAGACAAGAGGGAGCCAGGAAGTGGCCTGGACT
	ACAAGGCTAAGCATGGTAGCTTCAAGGTCTGCTGCCCTTGTGTTCTGAGAATACATTCCCCATCCCCAGCAGCTGCCACTCCATTCAGCTACCTGCTGGC
	AAGGGGCTTGCTGCTGATAGATCAGCCTCCTGCCTCAGCTGCAGCCCTGGGAATACCCAGTGCTGTTTCCTGTGCCTCTGGCCTCTAGGCCCTGTTGTGC
	AATAAACTGTGCTGACTCTCA
Exon11 101294196 - 101293760
	ACATTGGAGCTGCCACCAGGACTACGGAGCTCCCATCCAGAACGCTTCAGCCCATCTTCAGAAGCACCATGACCTGTGGATCAGGATTCTGTGGCCGCGC
	CTTCAGCTGCGCCTCAGCCTGCGGACCCAGGCCCGGCCGCTGCTGCATCTCTGCAGCTCCCTACAGGGGCATCTCCTGCTACCGCGGACTCTCAGGGGGC
	TTCGGCAGCCAGAGTGTCTGTGGGGCCTTCCGCTCTGGCTCCTGTGGACGCAGCTTCGGGTACCGCTCTGGAGGCATCTGCGGGCCCAGCCCACCCTGCA
	TCACCACCGTTTCTGTCAATGAGAGCCTGCTCACGCCCCTGAACCTGGAGATCGACCCCAATGCTCAGTGTGTGAAGCATGAGGAGAAGGAGCAGATCAA
	GTGTCTCAACAGCAAGTTCGCAGCCTTCATCGACAAG
Exon12 101293166 - 101292958
	GTGCGCTTCCTGGAGCAGCAGAACAAGCTGCTGGAGACCAAGTGGCAGTTCTACCAGAACCGCAAGTGCTGTGAGAGCAACATGGAGCCTCTGTTCGAGG
	GCTACATCGAGGCGCTGAGGCGGGAAGCTGAGTGTGTGGAGGCCGACAGCGGGAGGCTGGCTGCTGAGCTCAACCATGCACAGGAGTCCATGGAGGGCTA
	CAAGAAGAG
Exon13 101292253 - 101292193
	ATACGAGGAGGAAGTTTCTCTGAGAGCCACGGCCGAGAATGAGTTTGTGGCTCTGAAGAAG
Exon14 101291827 - 101291732
	GATGTGGACTGTGCCTACCTGCGCAAGTCAGATCTGGAGGCCAACGCAGAGGCACTGACCCAGGAGACCGACTTCCTGAGGAGAATGTATGACGAG
Exon15 101291565 - 101291401
	GAGACCCGCATCCTCCATTCCCACATCTCAGACACCTCCATCGTCGTCAAGATGGACAACAGCCGGGACCTGAACATGGACTGTGTCGTGGCTGAGATCA
	AGGCTCAGTATGATGACATTGCCAGCCGCAGCCGTGCTGAGGCTGAGTCCTGGTACCGCACCAAG
Exon16 101291177 - 101291052
	TGTGAGGAGATAAAGGCCACAGTGATCCGGCATGGAGAGACTCTGCGCCGCACCAGAGAGGAGATCAATGAGCTGAACAGAATGATCCAGAGGCTGACTG
	CTGAGATCGAGAATGCCAAGTGCCAG
Exon17 101290775 - 101290555
	AACACCAAGCTGGAGGCTGCTGTGACCCAGTCTGAGCAGCAGGGAGAGGCTGCCCTTGCTGATGCCCGCTGCAAGCTGGCTGAGCTGGAGGGTGCCCTGC
	AGAAGGCCAAGCAGGACATGGCCTGCCTGCTCAAGGAGTACCAGGAGGTGATGAACTCCAAGCTGGGGCTGGACGTTGAGATCACCACCTACAGGCGCCT
	GCTGGAGGGCGAGGAACAGAG
Exon18 101290330 - 101290299
	ACTGTGTGAAGGTGTAGGAGCTGTGAATGTCT
Exon19 101290001 - 101289492
	GTGTCAGCAGCTCCCGAGGAGGAGTCGTATGTGGGGACCTGTGTGTGTCAGGTTCCAGGCCAGTGATCGGCAGTGCCTGCAGCGCCCCCTGCAGCGGGAA
	CTTGGCGGTGAACACAGGCCTGTGCGCACCCTGTGGTTCAGCTGTGTCCTGTGGCCGTAAATGTTAAAAACTGCGTTCACATCCTGGCCCTGGCATAGCA
	TTTCGCCCTGAGCCATCTCTAGCTGACCAATATTGGGACCTAGAACAAGGGGCTCAGTCACTTGCTCACTTTGAAGCGACCCTCTCACTCTAGGCTCCTC
	TGGTCTCTCTAGACCACGCCCTTGTTCTCAGAAGTGAATACTGGCTTCTAGAAGTCCCTTTGGAGCTGCAGGGTGGGGAGTCTGGGGGCAGGGCTAGAAC
	ACCACCTATCCTGCCTTAACTGTGAGCCAGTAGCTAGAGAGCCACAGTCCCCCCTCCCTCTAATCTTTGTCTTGATCTGTTTCCAATAAATTAATGTAGT
	CAACTCTGCA
Exon20 101269235 - 101268818
	GGGGTCCAGCCTGACTCTGTATCGCCTCTGAACCATGTCTTGCTTCTCCTCCCGCCTCGGAGCCTCCTGTGGGGTCCGCGCCTTCAGCTGCGCCTCGGCA
	TGTGGTCCCCGGCCCGGCCGCTGCTGCATCTCTGCAGCTCCCTACAGGGGCATCTCCTGCTACCGCGGACTCTCAGGGGGCTTCGGCAGCCGCAGCGTCT
	GCGGGCCCTTCCGCTCTGGCTCCTGTGGACGCAGCTTCGGGTACCGATCTGGAGGCGTCTGCGGGCCCAGCCCCCCCTGCATCACCACCGTCTCTGTCAA
	TGAGAGCCTGCTCACACCCCTGAACCTGGAGATCGACCCCAATGCTCAGTGTGTGAAGCATGAGGAGAAGGAGCAGATCAAGTGTCTCAACAGCAAGTTC
	GCAGCCTTCATCGACAAG
Exon21 101267171 - 101266963
	GTGCGCTTCCTGGAGCAGCAGAACAAGCTGCTGGAGACCAAGTGGCAGTTCTACCAGAACCGCAAGTGTTGTGAGAGCAACATGGAGCCTCTGTTCGAGG
	GCTACATCGAGGCGCTGAGGCGGGAGGCTGAGTGTGTGGAGGCCGACAGCGGGAGGCTGGCAGCCGAGCTCAACCATGTGCAGGAGTCCATGGAGGGCTA
	CAAGAAGAG
Exon22 101265972 - 101265912
	GTATGAAGAGGAAGTGGCACTACGAGCCACTTCTGAGAATGAATTTGTGGCCCTGAAGAAG
Exon23 101265107 - 101265012
	GATGTGGACTGTGCCTACCTCCGGAAGTCAGACCTGGAGGCCAACGCAGAAGCGCTGACACAGGAGACCGACTTCCTGAGGCAACTGTATGAAGAG
Exon24 101264536 - 101264372
	GAAACACGTCTCCTCCATTCCCACATCTCAGACACCTCCGTCGTCGTCAAGATGGACAACAGCCGGGACCTGAACATGGACTGTGTCGTGGCTGAGATCA
	AGGCTCAGTATGATGACATTGCCAGCCGTAGCCGTGCTGAGGCTGAGTCCTGGTACCGCACCAAG
Exon25 101264148 - 101264023
	TGTGAGGAGATGAAGGCCACAGTGATCCGGCATGGAGAGACCCTGCGCCGCACCAGAGAGGAGATCAATGAGCTGAACAGAATGATCCAGAGGCTGACTG
	CTGAGATCGAGAATGCCAAGTGCCAG
Exon26 101263753 - 101263533
	AACACCAAGCTGGAGGCTGCTGTGACCCAATCTGAGCAACAGGGAGAGGCTGCCCTCACTGATGCCCGCTGCAAGCTGGCTGAGCTGGAGGGTGCCCTGC
	AGAAGGCTAAGCAGGATATGGCCTGCCTGCTCAAGGAATACCAGGAGGTGATGAACTCCAAGTTGGGGCTGGATGTCGAGATCATCACCTACAGGCGCCT
	GCTGGAGGGCGAGGAGCAGAG
Exon27 101262806 - 101262775
	GCTCTGCGAGGGTGTGGGCTCTGTGAATGTCT
Exon28 101262418 - 101261469
	GTGTCAGCAGCTCCCGTGGAGGAGTCACATGTGGGGGCCTCACCTATGGCACAACCCCAGGGCGCCAGATTGCCTCTGGACCCTCTGTCACTGGGGGCAG
	CATCACAGTGATGGCCCCTGACTCCTGCTCTCCTTGCCAGCCCCGCGCCTCCAGCTTCACCTGTGGGAGCAGCCGCTCAGTGCGCTTCGCTTAGTGCCAG
	GGCCTCCAAATGAGCCACCTGCCTGCCCCAGAGTGGAGTGGTGTGTGAATGGAAAATGTGTGCTTGCTTCCAGAATCTTCCAGATGTTCCTGTTTAGGGC
	CACTCTCCTCTGCCTTCTCCTTTTAGGGAGTTGTCTCCCAGTTCTCCTCTGGCTTCACTTTAGAAGGTCATTCCCAACCCTTCCCTTAACCCCAACCTGT
	CTTCAGATACTTGTAAATGATTTGTATTATTCGCAAAGCTCTCTGGGACACTACCAGTCACCCAGGCTGACTGGACAATAAAGTGTGGCCTTCCTGGGTC
	AAGGCATGATCCTAACCACCCAGCCATGCCCCCCCCCAAAACAAGAACCAGAGGGAACCCTTCCCAAGCAGCTCCCACTTCTGTCCCCAGGTACAGGGGC
	AGCAAGCATATGCCTTTAGTTGGTTGGGTTTACTAATCTCCTTAGCTGTGCCTTCCTTTGGGGCAAACTACTCTAATCACACTTCTTGGGTTACCTCCCA
	GAAAATAGTTGCTCTCTGGGGAGGCCTACTACCTACAGCCCCTGGCTAGGGGGCTTTGAACAGGTCTTGCTGTTCAAGAAGCCTTTGCACATTTCAAAGA
	CCCCCATACTGTTCCAGGCCTCCCTGTCTGTGCACAGGGAACTGTCCAAGGGGGAACTGGTGGGATGGGGACTATGGCCACTTTCTGTCTGGGTGCCTCG
	CCTTCTGGGTTGACCCCATCTGTGTTTCAATAAACGCTGCTTCAACGCAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+19dbEST_AA168336.1,dbEST_AA612388.1,dbEST_AA791687.1,dbEST_AI324610.1,REF_NM_001201323.1,GB_AF021836.1,GB_AK009099.1,GB_M92088.1,GB_AK133718.1,
23+20dbEST_AA727389.1,dbEST_AA727406.1,dbEST_AA562654.1,dbEST_AA791824.1,REF_NM_001201323.1,GB_AF021836.1,GB_AK009099.1,GB_M92088.1,GB_AK133718.1,
34+23dbEST_AA727389.1,dbEST_AA727406.1,dbEST_AA499055.1,dbEST_AA756738.1,REF_NM_001201323.1,GB_AF021836.1,GB_AK009099.1,GB_M92088.1,GB_AK133718.1,
45+28dbEST_AA929852.1,dbEST_AA756820.1,dbEST_AA727389.1,dbEST_AA727406.1,REF_NM_001201323.1,GB_M92088.1,GB_AK133718.1,
56a+41dbEST_AA929852.1,dbEST_AA562795.1,dbEST_AA930364.1,dbEST_AA756820.1,REF_NM_001201323.1,GB_AF021836.1,GB_AK009099.1,GB_M92088.1,GB_AK133718.1,
6a7+31dbEST_AA929852.1,dbEST_AA930364.1,dbEST_AA756820.1,dbEST_AA727406.1,REF_NM_001201323.1,GB_M92088.1,GB_AK133718.1,
6b7+0
78+32dbEST_AA060809.1,dbEST_AA673682.1,dbEST_AA498973.1,dbEST_AA152585.1,REF_NM_001201323.1,GB_M92088.1,GB_AK133718.1,
89+2REF_XM_003085068.1,REF_XM_003085984.1,
810+29dbEST_AA060809.1,dbEST_AA673682.1,dbEST_AA498973.1,dbEST_AA152585.1,REF_NM_001201323.1,GB_M92088.1,GB_AK133718.1,
910+2REF_XM_003085068.1,REF_XM_003085984.1,
1112+13dbEST_AA589567.1,dbEST_AA760264.1,dbEST_AA142335.1,dbEST_AA789954.1,REF_NM_001166157.1,GB_AF312018.1,
1213+11dbEST_AA792812.1,dbEST_AA161928.1,dbEST_AA168280.1,dbEST_AA562903.1,REF_NM_001166157.1,GB_AF312018.1,
1314+20dbEST_AA792812.1,dbEST_AA161928.1,dbEST_AA791542.1,dbEST_AA759468.1,REF_NM_001166157.1,GB_AF312018.1,
1415+19dbEST_AA792812.1,dbEST_AA760103.1,dbEST_AA791542.1,dbEST_AA759468.1,REF_NM_001166157.1,GB_AF312018.1,
1516+15dbEST_AA792812.1,dbEST_AA161928.1,dbEST_AA760103.1,dbEST_AA791542.1,REF_NM_001166157.1,GB_AF312018.1,
6a17+2GB_AF021836.1,GB_AK009099.1,
1617+12dbEST_AA792812.1,dbEST_AA161928.1,dbEST_AA760103.1,dbEST_AA791542.1,REF_NM_001166157.1,GB_AF312018.1,
1718+14dbEST_AA067967.1,dbEST_AA612367.1,dbEST_AA763077.1,dbEST_AA763244.1,REF_NM_001166157.1,GB_AF312018.1,
1819+14dbEST_AA067967.1,dbEST_AA612367.1,dbEST_AA763077.1,dbEST_AA763244.1,REF_NM_001166157.1,GB_AF312018.1,
2021+8dbEST_AA562782.1,dbEST_AA670816.1,dbEST_AA791259.1,ENSMUST00000081945,REF_NM_001003668.2,GB_BC139321.1,GB_BC139322.1,
2122+14dbEST_AA929968.1,dbEST_AA798809.1,dbEST_AA562782.1,dbEST_AA142768.1,REF_NM_001003668.2,GB_BC139321.1,GB_BC139322.1,
2223+14dbEST_AA929853.1,dbEST_AA929968.1,dbEST_AA798809.1,dbEST_AA562782.1,REF_NM_001003668.2,GB_BC139321.1,GB_BC139322.1,
2324+15dbEST_AA739140.1,dbEST_AA791823.1,dbEST_AA647220.1,dbEST_AA733748.1,REF_NM_001003668.2,GB_BC139321.1,GB_BC139322.1,
2425+16dbEST_AA560346.1,dbEST_AA760208.1,dbEST_AA725955.1,dbEST_AA798113.1,REF_NM_001003668.2,GB_BC139321.1,GB_BC139322.1,
2526+21dbEST_AA143978.1,dbEST_AA726587.1,dbEST_AA799195.1,dbEST_AA619616.1,REF_NM_001003668.2,GB_BC139321.1,GB_BC139322.1,
2627+15dbEST_AA717841.1,dbEST_AA612392.1,dbEST_AA726587.1,dbEST_AA799195.1,REF_NM_001003668.2,GB_BC139321.1,GB_BC139322.1,
1727+3dbEST_AA530769.1,dbEST_AA760529.1,GB_AF021836.1,
2728+24dbEST_AA717841.1,dbEST_AA154980.1,dbEST_AA612392.1,dbEST_AA791049.1,REF_NM_001003668.2,GB_AF021836.1,GB_AK009099.1,GB_BC139321.1,GB_BC139322.1,