NIA Mouse Gene Index (mm92)

Exon structure for U036686

chr15 -

Exon1 101755166 - 101754613
	ATTCAGGATCTGGCCTTTGCTTCGCTTCTGTTCTAAGCTCGTTGCAGCTGCCTCCTCTCTCAGCCATGATCGCCAGACAGTCAAGTGTCCGCGGAGCCTC
	CCGGGGCTTTAGCAGTGGCTCAGCTATTGCTGGTGGTGTCAAGCGAGTGGCCTTTAGCTCAGGCTCCATGTCTGGCGGTGCAGGGCGCTGCTCTTCTGGG
	GGCTTCGGCAGCAGAAGTCTTTACAACCTCGGGGGTCACAAGAGTATCTCCATGAGCGTGGCTGGGTCCTGCCAAGGCGGCGGCTATGGGGGTGCCGGAG
	GCTTCGGCGTTGGAGGATACGGTGCTGGGTTTGGTGCCGGTGGTTTTGGCGGTGGCTTTGGAGGCTCCTTCAACGGTCGAGGAGGTCCTGGCTTCCCAGT
	CTGTCCTGCTGGAGGTATTCAGGAAGTCACCATCAACCAGAGCCTGCTGACACCTCTTCAGGTGGAGATTGACCCAGAGATCCAGAAAATCCGCACGGCG
	GAGCGTGAGCAGATCAAGACCCTCAACAACAAATTCGCGTCCTTCATCGATAAG
Exon2 101753406 - 101753192
	GTGCGATTCTTAGAGCAACAGAACAAGGTCCTGGAGACCAAATGGAACCTCCTCCAGCAGCAGACAACCACCACATCTCCCAAAAGCCTGGATCCTTTCT
	TTGAGACTTACATCAACGCCTTGAGGAAGAACCTGGACACTTTGAGCAATGACAAAGGTCGCCTACAGTCAGAGCTAAAGATGATGCAGGACAGTGTGGA
	GGACTTCAAGACCAA
Exon3 101752203 - 101752143
	GTATGAAGAGGAGATCAACAAGCGTACAGCTGCAGAGAATGACTTCGTGGTCCTCAAGAAA
Exon4 101751757 - 101751662
	GATGTGGATGCTGCCTACATGATCAAGGTGGAGTTAGAGGCCAAGATGGAAAGCCTTAAGGATGAGATCAACTTCACGAGAGTCCTCTATGAAGCG
Exon5 101751146 - 101750982
	GAGCTGGCCCAGATGCAGACACATGTCTCAGACACATCTGTAGTGCTGTCCATGGACAACAACCGGAACCTGGACCTGGATGGCATCATCGCAGAGGTCC
	GGGCCCAGTATGAGGACATTGCTAGGAAGAGCAAGGCTGAGGTTGAATCCTGGTACCAGATCAAG
Exon6 101750832 - 101750707
	GTCCAGCAGCTCCAGATGTCAGCTGACCAACATGGAGATAGCCTGAAGACCACCAAGAATGAGATCTCAGAACTCAACAGGATGATCCAGAGGCTGCGGG
	CAGAGATTGAGAACATCAAGAAGCAG
Exon7 101750187 - 101749967
	AGCCAGACTCTGCAGGCATCTGTGGCTGATGCAGAGCAGCGTGGAGAGCTGGCCCTCAAAGATGCCTACAGCAAACGCGCAGAACTGGAGACTGCACTGC
	AGAAGGCCAAGGAGGACCTGGCCCGGCTGCTGAGGGACTACCAGGCTCTCATGAACGTCAAGCTGGCCCTGGATGTGGAGATTGCCACCTACAGGAAGCT
	GCTGGAGGGCGAGGAGTGCAG
Exon8 101749754 - 101749720
	GATGTCTGGAGAATGCAAGAGTGCTGTGAGCATCT
Exon9a 101749625 - 101749255
	CGGTAGTTGGCGGCAGCGCCAGCATTGGCGGCAGTGGCCTTGGCCTGGGTAGCGGTTTTTGCTCCGGTTCTGGTTCTGGAAGTGGCTTTGGATTTGGTGG
	TGGCATTTATGGCGGTTCTGGTTCCAAGATCACCTCTTCCGCCACCATCACCAAGAGGTCCCCACGATAGGCGAGACGGGATCCTGATGGCCCTGAGCCC
	GGCAGGGTCAGCCGTTCCTGATATCTCCTGTGCGATCTTCACTTCACCTCCAGTCTTCCTGGTGCTCATCTTGTTACTCTTCCCCCTCTGCCTTGGTCCC
	TCAGTTCCAGGACGATCTTCTTGGCCATGGTGTGACCTCTGTTCTATTGGAACCTGGTAGCTTCTTCTCAA
Exon9b 101749254 - 101748966
	CTTGGGTCAAGTGGCCCCCCACCCCCTGCATGGGAGGGGTGTCTGATTTCACCCCAATGGACAGAGGGGATGAAGAGCAGAAACTCCTTCTGCAGATGTA
	CACTGTCACTCTCAGCTCCTCTCGTCACACCGGCTTCCACCTGATCCTGGAGATCTATGTTCTACAATGATGCTCATTCTCCATCACCTGGCAGCAACGG
	GCTCTGCCAGGTCAACAAGGACTGCTTGGTGTCCCGTGCAACCCTGCTCCTCTCTCTACTCATCCCCAATAAAATGCTTTTGTCATTCA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+18dbEST_AA087310.1,dbEST_AI115108.1,dbEST_AW106316.1,dbEST_BF142765.1,REF_NM_008475.2,GB_BC064008.1,GB_X03491.1,GB_BC145839.1,GB_BC145841.1,
23+16dbEST_AA895482.1,dbEST_AA087310.1,dbEST_AA530155.1,dbEST_BF142765.1,REF_NM_008475.2,GB_BC064008.1,GB_X03491.1,GB_BC145839.1,GB_BC145841.1,
34+19dbEST_AA087310.1,dbEST_AA530155.1,dbEST_BF142765.1,dbEST_BQ222770.1,REF_NM_008475.2,GB_BC064008.1,GB_X03491.1,GB_BC145839.1,GB_BC145841.1,
45+16dbEST_CB589628.1,dbEST_EH112367.1,dbEST_EH095658.1,dbEST_EH097943.1,REF_NM_008475.2,GB_BC064008.1,GB_X03491.1,GB_BC145839.1,GB_BC145841.1,
56+14dbEST_AA755257.1,dbEST_AA038826.1,dbEST_AA895482.1,dbEST_AI316266.1,REF_NM_008475.2,GB_BC064008.1,GB_X03491.1,GB_BC145839.1,GB_BC145841.1,
67+19dbEST_AA089205.1,dbEST_AA755257.1,dbEST_AA038826.1,dbEST_AA895482.1,REF_NM_008475.2,GB_BC064008.1,GB_X03491.1,GB_BC145839.1,GB_BC145841.1,
78+25dbEST_AA089205.1,dbEST_AA755257.1,dbEST_AI326654.1,dbEST_AI316266.1,REF_NM_008475.2,GB_BC064008.1,GB_X03491.1,GB_BC145839.1,GB_BC145841.1,
89a+24dbEST_AA089205.1,dbEST_AI326654.1,dbEST_AI316266.1,dbEST_AW108092.1,REF_NM_008475.2,GB_BC064008.1,GB_X03491.1,GB_BC145839.1,GB_BC145841.1,
9a1-1dbEST_EH097685.1,