NIA Mouse Gene Index (mm92)

Exon structure for U037662

chr17 -

Exon1a 32458183 - 32458050
	GCCCATTTGAGCAACCAATGGTAGCGCCCAGAAAGAGACGTACGCTCTTCGTCTTCCAGTAGCAGACAGCACGTTGAACGCATGCGTTCTGAGCGAATCT
	AAGACAAGGATCTGCTGGCGGGTCGCGTCGCAGA
Exon1b 32458049 - 32458030
	CATGGAGCAAGGCTACGGAG
Exon1c 32458029 - 32457852
	GTTAGTGTGGGCTCTTCTTCACCACGGGAGACCCTGGCGCATGTGGTATTCGGGCTTAGCCTGCAGCCGGAACGCACTTGCCGCAGCCCGGTTCTGTGTG
	GAGTTGTCCCGGACGCGCGCGCTTCCCTTATTGGGCCTCTGCGCAATCGTTCCCGAAGCGCCGCGCGTGGATTGGCCG
Exon2a 32457670 - 32457604
	AGGGGCGGGGCTAAAGCGAACGCTGAGGAAGCGGGGGGTGGAGGGGGTTGAGGTCCGGCTGGGTTGC
Exon2b 32457603 - 32457430
	GGCGGCCGTAGCGAGGAGAGAGTCTCAGCTCATCCTCCGCAGGTCGTCCTTGAGAGCTCGTGTCCCCGGGCTCGCTTTTCTGAAGGCTTACGGGCAGCGC
	GCGATCGGCCCAGCTGTGCACTGCGGCTACACCCGGTGCAGCTTTTTGGGAAAACCTGGCTGGGTCTCTGCAGT
Exon2c 32457429 - 32457403
	GTACGCGGCGTGAGGTGCTCGTGGGAG
Exon3a 32455754 - 32455750
	GCTAT
Exon3b 32455749 - 32455716
	GGGGCATGGAGTGCTGGACCTGCCAACACCCAGG
Exon3c 32455715 - 32455494
	GTAAGTGGTTCCTGATTAATGGGTTGGCTTGTGGGTTTCTCCACTGCATGCCCCCTTGTAGTAGAGCCCAGCATCTGTCTTCCCTAGGGGACATTTTGCC
	TTTTTTTTCTTTTTAAGGAAAAACAGTACTACATGGGAGCGGAGGCTGATTAGTAAGAAGAATGCTCCTTGTGTCACTCTGCTACCTGCCACCACAGGCC
	TCAGTAGCACCCATGCACCCCT
Exon4a 32454823 - 32454791
	GTACATATGGAAGTGGTATGACCAGCTGGCAAG
Retained Intron 32454790 - 32454292
	GTAAGACCTTCTGAAAGGGACCTTGAGGTGGGCAAGTGAGTCTTTAAACAGCCATCCAGAGGTACAGGTCCCCACTCCCCCATCCTGGCTGTGCACATGG
	CTCTGTCGATAGCCCGGAGAATAAGGCTGCTGGGCCCTGAGGCGTATCAGAGCTAGGCTGACCTGAAGGGGAGTTTGAACTTGTTTGAGAGGGATTGTGG
	ATATAGTGCAGGAACACTTTTCAAATGTCTTTGTTAGTACCTGGAATTGCTATTCTGAGGTTCTTGGCCATCTTTGATTAGGAAACAAGTCCTTCTGTCT
	CTTAAAGAAAACCTGCTACTACAATCTGTGGCCACCTGTCTCTCTGGTCTTGATCACATGTGTATTGTGGTATGATGTTGGTAATGCTTAGTTCCATAAC
	TTTTTCCTTCTTGGTGGGCAGAGAGTGCTCCTGCAGACAAGAATGTCATGGCTAGCCTCATGTGCTCAGGCCTAACATGGTTCTTCTTTCTCCTGATAG
Exon5a 32454291 - 32454012
	GTTATGAAAACTACAACTACTACAATGCCCAGAACACCAGTGTCCCTGCAGGAACACCCTATAGTTACGGCCCAGCCTCATGGGAGGCCACCAAGACCAA
	TGATGGTGGCCTGGCAGCTGGGAGCCCTGCCATGCATGTGGCGTCTTTTGCCCCAGAGCCATGTACCGACAACTCAGACTCGCTCATTGCCAAGATCAAT
	CAACGTTTGGACATGTTGTCTAAGGAAGGAGGCAGGGGTGGGATCAGCAGCGGTGGGGAGGGCGTGCAGGACCGAGACAG
Retained Intron 32454011 - 32453613
	GTGATTATGGCCTTCAACCTTTGCTCATGGAATCCCTTTCTGGAATCACGGGAGTGGGTACCAGCTCTTTTAGAAAGCCCTCTTTCCTGTTCCTCCTTTA
	GGCTGGAGTTGGACCCTGTGGGGTGGGCTTCACTGAAGGTTTCCTAAACTGCTGGCCAATGAGCCTAAGATTCTTTGTTCTGGCAAGGGCTTCATGCTCT
	TTCTTTGTTAGCAGTGTTTGAATGAGTGTTCTTAGGCTAGTTTGCCTTCTGGGCATTTAGGTAGATACTGACTGGGTGGGTTGGTTTCTTGTTCTGAATG
	TAAGAGGTCCAACTTAGTGTAAAGTTAGGCTGAGGGCAGATTATTGGGTAGCCTGGATGGCTTAGGCTGCTCCTAATGGGCTGTATACTTCCTTTGCAG
Exon6a 32453612 - 32453132
	CTCCTTCCGCTTCCAGCCATACGAGTCCTACGACGCCAGGCCCTGTATACCTGAGCATAATCCCTACCGCCCCGGCTACGGTTATGATTATGACTTTGAC
	TTGGGAACTGACCGCAATGGTAGCTTTGGTGGGACATTCAACGACTGTCGGGACCCAGCCCCAGAGCGGGGCTCCCTTGATGGTTTCTTGAGGGGCCGGG
	GCCAGGGCCGCTTCCAAGACCGGAGCAACTCCAGCACCTTCATACGTAGTGACCCTTTCATGCCACCCTCAGCCTCGGAGCCCTTATCCACTACGTGGAA
	TGAGCTGAACTACATGGGTGGCCGTGGTCTCGGTGGGCCCTCCACCAGCAGGCCACCTCCTTCCCTCTTCTCCCAGTCCATGGCCCCTGACTACAGCATG
	ATGGGCATGCAGGGGGTGGGCGGTTTTGGTGGTACCATGCCTTACGGATGTGGCCGGTCCCAGACGCGGATACGGGATTGG
Retained Intron 32453131 - 32452730
	GTAAGTTCGCCAAGTTCTGTCAGGCCTTACTGCCTTTTCTTCCTGACACCTTTGTTGAGCTAAAAGTTTGCATACTGTAAGATGCCCTCATTTCCCAGTG
	TCCAGTTTACTTTTAGTACGTTTACACCACTTGCTTTAGATGTGTccatcatctgttctctagtcctagctctgggttgacctgttgtagatatttcaca
	gcaatagagtcacacatgtggctttgtgtgtctggctccctCAAGCATGACATGGGCTTTTGGACTCTTATTATAGTCTCACTTTTTTGAAGGCTTTTTC
	CTGCCTTTGTTTTCTGTCCTTACAAGTGCTGATCTTTATTTTGTTTGGGGGGCATCTTACAGGCCCAGGTTAGCAGTACATGACATGTGTTTGTGTCTGT
	AG
Exon7 32452729 - 32452600
	CCTAGAAGGAGGGGGTTTGAACGCTTTGGACCAGACAACATGGGCAGGAAGCGGAAGCAGTTTCCATTGTATGAAGAACCTGATGCCAAACTGGCCCGTG
	CTGACAGTGACGGAGATCTGTCTGAAAACG
Exon8 32452433 - 32452387
	ATGATGGAGCTGGTGACTTAAGATCAGGAGATGAAGAATTCAGGGGG
Exon9 32451089 - 32451056
	GAGGATGACTTGTGTGACTCCAGGAAGCAGAGAG
Exon10a 32450207 - 32449319
	GTCCTGCTACCCAACCGGGATGACTTTGCTATTAAACAGCAGTCATAGTTTCAGGCAGTGACCTCTTGCCAAAAGTCCCACACGTCCTTTTGAGAGGCTT
	CTGAGCAGCGCACGCCGGTCGCCATCTTCGTGGGACAGTCTCGGGACTGGCACCAGGGGTAGGGGTTACAGTTCAGATGCTTATCCAACCTTTTTTCAGC
	ATCCAGCCTTGACCCTCAGCCTGGGGCTCTGGTGTGGTCTCATGCTGAGATGCTGGCCACAGGCCTCTCCTGGGAGCTATGCCAGCCCCAAGGAGTAGAT
	GGGAGGACCAGTCGGTCTCTTCCCATTTTTGTTTCTAGGATTGTTTCCCACCTGGCCTTGGGAAAGTCCAAGGATGTTGGTTTTGTGAGTGGAAACTAGA
	GATTGGGCCAGCAAGGACTGTCAGACCTGCTGAGTCCCTAGTTCAGATGAAGCCAGCAAGACAGTCACCACAACCCACCTAGACATGGGATGGAGGGTGG
	CACTGCAGCTTGTTATATTTCCTGAGACTTTCTAGCTGCTGCCTCTGTTGGGGATATTTGCAGCTCTTTGAGTGATGTGGGAGAAGAGCCAACAACAAAG
	TGATATATTGGACAACAGCCTGGGACAGAACAGAGTAGGTGGCCATGAGTGGGATGGGCCTCTGCCCATCAGGCCATGGGAGGAGTGAGGCAACTCCTCT
	GGGTTCTCATCCTGGTACACCAGGAACCTCTAACAGCTCCTCGGTGCCTTGGGGTATCCTAGCCCCACCACAAATGTAATGGAAGCTGGGCACAGGGTGT
	GGCTGCCAGGCTGCAGCATCCAACTTGGCCCCTGGAGCTGAGCTTTCCTGCAGGCTCCTCAGTGTCTCGAGGGGACTTTTCTGTTACAG
Exon10b 32449318 - 32449231
	GAGAAAAGGAGGACGAGGATGAGGATGTGAAGAAGAGACGGGAGAAACAAAGGAGGAGAGACAGGATGCGGGACCGAGCAGCTGACAG
Exon11 32448039 - 32447898
	GATTCAGTTTGCCTGTTCTGTATGCAAGTTTCGTAGCTTTGAAGATGAAGAAATTCAAAAGCATCTGCAAAGTAAATTTCACAAAGAGACTTTGCGATTT
	ATAAGTACCAAACTGCCCGACAAGACAGTAGAATTCCTCCAG
Exon12 32447616 - 32447523
	GAGTACATCATAAACAGGAATAAGAAAATTGAGAAACGGCGTCAGGAGTTGTTGGAGAAGGAGAGCCCTAAACCCAAACCAGATCCATTCAAAG
Exon13 32446494 - 32446364
	GCATTGGCCAGGAGCATTTCTTCAAAAAGATTGAAGCCGCACATTGCCTAGCCTGTGACATGCTGATTCCTGCGCAGCATCAGCTTCTCCAGCGGCATCT
	GCATTCCGTGGACCATAACCATAATCGAAGG
Exon14 32443530 - 32443435
	TTGGCTGCTGAGCAGTTCAAGAAAACAAGTCTCCATGTGGCTAAGAGTGTTTTGAACAACAAACATATAGTGAAGATGCTGGAAAAATACCTCAAG
Exon15 32442651 - 32440617
	GGTGAGGATCCTTTTGTCAATGAAACTGCTGACCTTGAGACAGAAGGAGATGAAAATGTAGGAGAGGAGAAGGAGGAGACACCAGAGGAGGTAGCTGCCG
	AAGTCTTAGCAGAGGTGATCACAGCAGCAGTGAAGGCTGTAGAGGGGGAAGGAGAACCTGCTGCAGCGCATAGTGACGTCCTAACTGAAGTGGAAGGGCC
	TGTGGACACAGCAGAGGCCAGCAGTGACCCCCACACTGAAAAGCTACTAGAAGAGCAGACCTGTGAAGCAGCATCTGAAACCAGGAGCATCGAAGACAAG
	ACCAGAGGTGAGGCTGCTGAGGCCAGAAACGAAGCAGCTATGCCAACAGCAGACGCAGGAAGCACGTTACCTGTCATAGCAATCCCGGGAATCATGGAAG
	ATGAGCTGGAACAAACTGGTGCAGAGGCCAAAGATATTCCCACCGAATGATTTTTTTCTTCCCTGTTTCAAGGGATATGTTATATATCATGTGTTCTTTT
	TATTTTATAAGATGTACTAGGGTGTGTATTATTTGGTGGAAAGATTGGGCCATTTCCTTCCCAATGTACCTCAAGGATTGATGCTATACAGTAGATGGCT
	TCCTACCTCTGTTAGAATACAAAAAGAGGTAAACCATTTTCCCAAGTGGCCTTTGATGGCTATCTGTGCACTGCAGTTAGAATAATAAAAGTAGATCTTC
	CTGGTAATTGTTAAGTCCTAAAACGGACAGAATGTGAGGATTTTTTTGTGTGTGTGTTATGTTTTTGTTTGGTTGGTCTTTGTTTCGTTTTATTTGCTTT
	TTCTCCTGGAAAGCAATTTGTTACAAATATAACTTGTTTGAGGGGGAAAAAATTAATTATTTAGGGGAATTCCCTTATTCACATATGAATTTATTCATAA
	ATTATGCATGGTTGATGTGGGACACACACGATTCAACCATCCATGTGTGCGAGAGCTCAGATTGTGCCCCCTACCAATAACAGTCCTGCCTGTTTCAATA
	AACATCAGACCAATTTTTTGTTTGTTTTGTTTTTGGTTGGttggtttttcgagacagggtttctctctgtagccctgactgtcctggaactcactctgta
	gaccaggcaggcctcaaactcagaaatctacctgcctctgcctcccaagtgctgggattaaaggcatgcgccaccatgcccggctCATCAGACCTTTTTT
	TAAGGCCTTTATTTTAGCTTTGGCAttgagatagcatcttgcttggaccaagcttgcctttgaattcaatcctcctatctcagtctctggagtactagga
	ccatgtgtgtacagccaagctcagctGGGCTTTGGTTTTATAATACACTGTATTCTATGTTCCTCACCTGATGTGGCAGCATCCTGTTAACTAAAGGCAT
	AACAAGATGGTGACCTTGGCCTGTGTATAAGATTGTCAGAGCTGTTCCATAGGAAGCATGCCTACCTGGGCCTCTAGAGTGAAGACACTGCCGAAGGCAT
	TCGTTCTCTCTGTTCAGTGCTTGCTAATCAGTTTGATGTTTGTGTTCCACCTCTATTTGTGCAGGATTATGGGTTTTTGTTTTGTTTTCTCTTAATTTTG
	TTATTTCCACCTAAAAGTACTTAGGAAAAAAACCTGAAATTACTCATTGATGAAAAACAAATGTAAACTTCCGTAGATGGGATCTATCTGTAAAAAGCTC
	ACACAGTTACGTAAAGATGTTTCATTTTAAGCAAATAGTATTCCTTTGGCAGTTCTGAGTCTGAGAAAGGGAGGCTCAGCATGTCTGTAAAGTAGCATGT
	ACTAGGTTTTATAGGGTCAGTATGATGGGTTTTCCTCCCTTTTGAAGTTACAATACTGTGTCCATTAACTGTACACAGATCACATCTTGGAAATATCAAC
	CAGTGAAGAATTATAAAAGAGGCAATAAAATATTGCAGGGATTAAATCAGCACTCTGTGAAGGAGCATTACTAGGGGGTAGGAGATGCACTTTGGGAATA
	TCCTCGAAACAAGCAATAAACTGATGCCACGAAGA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
2b3a+2dbEST_BB657686.1,dbEST_BY281413.1,
1b3a+107dbEST_AV477034.1,dbEST_BB853206.1,dbEST_BB838721.1,dbEST_BB840681.1,REF_NM_019774.4,GB_BC060170.1,GB_BC060209.1,GB_BC078448.1,GB_BC042602.1,GB_AK089092.1,GB_BC125521.1,GB_BC137746.1,GB_AB028920.1,GB_BC054433.1,GB_AK004801.1,GB_AK143300.1,
1c3a+5dbEST_BB861327.1,dbEST_CJ079703.1,dbEST_CJ075442.1,dbEST_CJ083324.1,
2c3a+5dbEST_BY260521.1,dbEST_BY275273.1,dbEST_BY271972.1,dbEST_CN685535.1,
3c4a+1dbEST_CB722656.1,
3b4a+134dbEST_AV477034.1,dbEST_BB657686.1,dbEST_BB853206.1,dbEST_BB838721.1,REF_NM_019774.4,GB_BC060170.1,GB_BC060209.1,GB_BC078448.1,GB_BC042602.1,GB_AK089092.1,GB_BC125521.1,GB_BC137746.1,GB_AB028920.1,GB_AK004801.1,
4a5a+141dbEST_AV477034.1,dbEST_BB657686.1,dbEST_BB853206.1,dbEST_BB838721.1,REF_NM_019774.4,GB_BC060170.1,GB_BC060209.1,GB_BC078448.1,GB_BC042602.1,GB_AK089092.1,GB_BC125521.1,GB_BC137746.1,GB_AB028920.1,GB_AK004801.1,
3b6a+5dbEST_BI739923.1,dbEST_BM878231.1,dbEST_BY260521.1,dbEST_CF748151.1,GB_BC054433.1,
4a6a+2dbEST_CN674145.1,NIA_A0944F08-5,
5a6a+69dbEST_AV513002.1,dbEST_BB657686.1,dbEST_BB853206.1,dbEST_BB838721.1,REF_NM_019774.4,GB_BC060170.1,GB_BC078448.1,GB_BC042602.1,GB_AK089092.1,GB_BC125521.1,GB_BC137746.1,GB_AB028920.1,GB_AK004801.1,
6a7+60dbEST_BG174529.1,dbEST_BI739923.1,dbEST_BQ891146.1,dbEST_BU514056.1,REF_NM_019774.4,GB_BC060170.1,GB_BC060209.1,GB_BC042602.1,GB_AK089092.1,GB_BC125521.1,GB_BC137746.1,GB_AB028920.1,GB_BC054433.1,GB_AK004801.1,
78+57dbEST_BE992335.1,dbEST_BE992680.1,dbEST_BG174529.1,dbEST_BI986188.1,REF_NM_019774.4,GB_BC060170.1,GB_BC060209.1,GB_BC078448.1,GB_BC042602.1,GB_AK089092.1,GB_BC125521.1,GB_BC137746.1,GB_AB028920.1,GB_BC054433.1,GB_AK004801.1,GB_AK143300.1,GB_AK030964.1,
89+48dbEST_BG174529.1,dbEST_BI986188.1,dbEST_BU708973.1,dbEST_BU514056.1,REF_NM_019774.4,GB_BC060170.1,GB_BC060209.1,GB_BC078448.1,GB_BC042602.1,GB_AK089092.1,GB_BC125521.1,GB_BC137746.1,GB_AB028920.1,GB_BC054433.1,GB_AK004801.1,
910a+3GB_BC060170.1,GB_BC042602.1,GB_BC054433.1,
910b+41dbEST_BI986188.1,dbEST_BU708973.1,dbEST_BU514056.1,dbEST_CA883510.1,REF_NM_019774.4,GB_BC060209.1,GB_BC078448.1,GB_AK089092.1,GB_BC125521.1,GB_BC137746.1,GB_AB028920.1,GB_AK004801.1,
10b11+37dbEST_AV237587.1,dbEST_BE854591.1,dbEST_BI986188.1,dbEST_BU708973.1,REF_NM_019774.4,GB_BC060170.1,GB_BC060209.1,GB_BC078448.1,GB_BC042602.1,GB_AK089092.1,GB_BC125521.1,GB_BC137746.1,GB_AB028920.1,GB_BC054433.1,GB_AK004801.1,
1112+28dbEST_AI157148.1,dbEST_AV237587.1,dbEST_BB151919.1,dbEST_BG089342.1,REF_NM_019774.4,GB_BC060170.1,GB_BC060209.1,GB_BC078448.1,GB_BC042602.1,GB_AK089092.1,GB_BC125521.1,GB_BC137746.1,GB_AB028920.1,GB_BC054433.1,GB_AK004801.1,
1213+32dbEST_AA240924.1,dbEST_AA067731.1,dbEST_AA823923.1,dbEST_AI157148.1,REF_NM_019774.4,GB_BC060170.1,GB_BC060209.1,GB_BC078448.1,GB_BC042602.1,GB_AK089092.1,GB_BC125521.1,GB_BC137746.1,GB_AB028920.1,GB_BC054433.1,GB_AK004801.1,
1314+33dbEST_AA240924.1,dbEST_AA067731.1,dbEST_AI157148.1,dbEST_AL360731.1,REF_NM_019774.4,GB_BC060170.1,GB_BC060209.1,GB_BC078448.1,GB_BC042602.1,GB_AK089092.1,GB_BC125521.1,GB_BC137746.1,GB_AB028920.1,GB_BC054433.1,GB_AK004801.1,
1415+39dbEST_AA240924.1,dbEST_AA067731.1,dbEST_AI157148.1,dbEST_AL360731.1,REF_NM_019774.4,GB_BC060170.1,GB_BC060209.1,GB_BC078448.1,GB_BC042602.1,GB_AK089092.1,GB_BC125521.1,GB_BC137746.1,GB_AB028920.1,GB_BC054433.1,GB_AK004801.1,