NIA Mouse Gene Index (mm92)

Exon structure for U038334

chr18 -

Exon1 36614178 - 36614107
	CCGGCTTGCCTCTAGCGCAGGCGCAGAGAGTGCTCCAATATGGCCGCCTCCGTGGATCTGGAGTTGAAGAAG
Exon2 36610900 - 36610734
	GCCTTCACAGAGCTTCAAGCCAAAGTTATCGATACTCAACAGAAGGTGAAGCTTGCAGACATACAGATTGAACAGCTGAACAGAACGAAAAAGCACGCAC
	ACCTTACGGACACGGAGATCATGACGCTGGTAGATGAGACTAACATGTACGAAGGTGTAGGAAGAAT
Exon3 36592044 - 36591960
	GTTTATTCTACAGTCCAAGGAAGTAATTCACAACCAGCTGTTAGAAAAACAGAAAATAGCAGAAGAAAAAATTAAAGAGCTGGAG
Exon4a 36564114 - 36563980
	CAGAAGAAATCCTACCTGGAGCGGAGCGTCAAGGAGGCTGAGGACAACATCCGGGAGATGCTGATGGCGCGGAGGGCACAGTAGGAGCTGCTGGGAAGCG
	CCTTCCGTTCTGATCCCTCACATCCTGTCACGGCA
Exon4b 36563979 - 36563333
	GGGGCTGTGCAGGGTACTGCCCTCCCTCTGCCCAGCAGCCCCATCTCTCCATCACCCTGAGCCCCTCAGGTCCCAACTGAATGTCTGCCAACCCCTGCTC
	AGGACACTCTTCTTTCCTGGGGCAAGCCAGGAGCTCTCAACAGAGGGAGGACTGGAGGGCAGATGGAGAAAGCTGTCCAAGCCTGTCACTAGGCATGTGG
	GTTAGACCAGGTTAGACCAATAAAAAGCTATGTCTTTACTTTATGGCATGTGCTTTTCTCCACCGGAGGAGAGAGAGGCAAGTGTCTCCCTCAGCTTGTG
	TCCCTTTTTTCCTCCCCTTTCTGTCCTGGGCCTCTGTGTAGAGCATGGAGGAAGAAGACGACAAGTTGATAGGTGTGGTGGACAGAGGCACAGTTGGCTT
	CAGGGTTCCTTCCCTGTTTTCTCCCCAGAATTCTAAAACAAAGTTCAGTGGCGAGCAGCATCTCTAGGCTCTGGTCCTGTCTGGCCAtggtgcgcccgtg
	gccctgcctcctagtgctcaggacagctcattctctgtgcaactttcaggaactttactgcaggtcagttaaacacaactgttactgaaaactagatgta
	aacttaagtatttagaacaaaaactactagtaaatactcagaactcc

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+102dbEST_BY711718.1,dbEST_BY703590.1,dbEST_CK789710.1,dbEST_CK129857.1,REF_NM_026027.3,GB_AK012575.1,GB_AK002575.1,GB_BC024693.1,GB_AK010532.1,GB_AK003330.1,GB_BC094627.1,GB_AK028148.1,
23+148dbEST_BY711718.1,dbEST_BY703590.1,dbEST_BI987473.1,dbEST_BI963578.1,REF_NM_026027.3,GB_AK012575.1,GB_AK002575.1,GB_BC024693.1,GB_AK010532.1,GB_AK003330.1,GB_BC094627.1,GB_AK028148.1,
34a+146dbEST_BY711718.1,dbEST_BY703590.1,dbEST_AA031128.1,dbEST_AI835959.1,REF_NM_026027.3,GB_AK012575.1,GB_AK002575.1,GB_BC024693.1,GB_AK010532.1,GB_AK003330.1,GB_BC094627.1,
4a1-0