NIA Mouse Gene Index (mm92)

Exon structure for U038815

chr19 -

Exon1 11023795 - 11022768
	CGGAAATGGACGAGTCTGACGTCATATGAAGGCGCCGACAGTTCCGAAGGCTACAGAGGCTACACGTGAGCCATGGATACGCCGCTGAGGCGCAGCCGGC
	GGCTGGAAGGCCTAAAACCTCTGTCTCCAGAAAACCTTCCTGTCCCCGAAGTCTCTCGGGCGAAACGGGCTCTTGTAGATTTCAAGTCGAACTCAGAAGA
	AACAGGAGAGCTCAAGTCTACGAGAGTTCCACCACTGAGCCTTCCGTCTCCCGGACCTCAGCCGGAGACGAGCCCCGGATCGCCCTGTCCACCACTGAGC
	CTTCCGTCTCCCGGACCTCAGCCGGAGACGAGCCCCGGATCGCCCTGTCCACCACTGAGCCTTCCGTCTCCCGGACCTCAGCCGGAGACGAGCCCCGGAT
	CGCCCTGTCCACCACTGAGCCTTCCGTCTCCCGGACCTCAGCCAGAGACGAGCCCCGGATCGCCCTGTCCACCACTGAGCCTTCCGTCTCCCGGACCTCA
	GCCAGAGGCGAGCCCCGGATCACCCGGTCCTAGACAGGATGCAGACGATGGGTCCCCACAAAGGCAGCCAGAGCCTCACCCCGGGTCCCTTCAACCTCAT
	CAAGATCTGGGCCTGGAGTCACCTGCAGGACAGACAGAGTCGAGCCCGGAATCCCCGCAACGAGAGCAGCCATCCAAATTACCTCCCCCACAGGGAGAAC
	TGGACTCTGAGGCGGCCCACGCTAAAGAGGAGGTGATCCCAGGATCCCCCGAGCCTTGCCCGGGCCAGCAAGCACCGGGTCCCGAGCCCTCTCAGCCAGC
	ACAGGAGCTGACGGTCCAGGCACCTAGCTCCCCAGAGCGCCAGTTGGAGCCAGGCAAGCTGCCTCCGGCGGGAGAGACAGTAACAGAAAGTCTCAACCTA
	AAGAAGCGAGTTATAGCCTCTCCCCAGGCCCCAGCGTCCAAGAAATTGAAAGAGAAGGAGGAGCTTCCTGTAATTCCGAAAGGGAAGCCCAAATCCGGGC
	GTGTGTGGAAAGACCGCTCCAAGAAGAG
Exon2 11021822 - 11021459
	TACTGGCCAGAGACAAGAACTCGTAAGAGTAAGGGAGCAGGGCATCAGAGATTTTAAGAAAATGACGTTGAATAAGGGTGGACCGTGCGAGGCTCCGTGC
	AGGCTCTTTACAGAAGTCATTTTGTTATACTCTTAAATCCTAAGCGCAGGGGATAACCCCTCCCGCAAGCACACCCCATTAAACAGAGGAAAGTGAGGCT
	TAAAGAGAAAGGCACCAAGCGGAGAAACTTTGAAGCTGTTCCTTTTCCCTGTCCGAGCAAACCACAATACAGGCCACTGATGGCCACGGGTGACCAGCCA
	GACGGGCTCGCACACAGAAGGGCGCGGTGGCTGAGAGGCTTCCTTGCACAGGCTCGCATAGGCA
Exon3 11019902 - 11019773
	GTTCTCCCAGATGGTTCAGGACAAGCCCCTGCGTACCTCCTGGCAGCGGAAGATGAAGGAGCGACAGGAGAGAAAGCTGGCTAAGGACTTCGCCCGACAC
	CTGGAGGAGGAGAAACAGAGGCGCCGGCAG
Exon4 11018042 - 11017968
	GAGAAGAAAGAGCGCCGGGCTGAAAACCTGAGACGCCGTCTAGAAAATGAGCGCAAGGCTGAGATTGTCCAAGTG
Exon5 11017779 - 11015971
	ATCCGCAATCCTGCCAAGCTCAAGAAAGCAAAGAAGAAGCAGTTGCGTTCTATTGAAAAACGAGACACCCTGGCCTTGCTCCAGAAACAGCCACCCCAGA
	GGCCTGTAGCCAAGGTCTGAGTTCAGGACAGTCCATAGGCCTCAGCAAACAAGGCACTTCTCAGGCCACTGACTGACACCTCTCCTGGAGCCAGCACACC
	AACGCTGTCACATTAAGACGGAGACTCCAGCCCAGAGGGAACTGACGACTATGCTGGGACTCAAGAGAGATTTAACTGTCCCCATCTCCTTTCCCGCCTG
	TTCCAAAGTGCCTTATAGTCATAAACTGTTgctgggtggttgcagcaatgcacaccttttatccccgtgctcaggagacagagacaggcagctctcagag
	ttcgaggccagtcttgtctatagagtacaggatagccagggctacacagagaagtcgtatctaaaaaaaaaaaaaATCAAAACAACAAAAGAGGTCTTCA
	GCTGTGAATTCTTGTTTCCCAGTGAGCTAATAAATCCCTGACTTGGGGTCCTGGGTGTTACCCACGCCTGAAGGTCTGCTGTCAGAAGTCAGTACCTCCA
	TTTTTTCAGTGACATCTTGGCCACTTGTGGATTCTACTGATTTGGTCCCCTCAGTCAACTGAAGCTAGCCTTTCCCTAGTTTAGCACTAAAAGATTAAAG
	TAGGGTGTTACAGGGAGCTGAGTTTCTCTCCAGCACCCCTTTGCCACACTGGACTGTAGAAGCCTCGAGGCTTGAGTCATACCTACCTGCTCTATTGCAG
	AGGTGTTTATTGGTATCTGCATAAGTACAGCTCTGGGCTCCCCGAAGGACAGAAGCCCCTGCCCCACTTGGCTTTCATTATCATAATAAACCATTGAAAT
	AATGGTGTGACAGGTACACTGAGTAAAGCAGGAGGGACTTGGTGACATTTTACTCTCCAGTTTGAGAAGCGCCTGCCACAGGCTTGAGGCCTGCTCAACA
	CAACTGACAACCAGCCTGGCCTTGCGTGGTTCAGGAGATCCTGAGACTACCCCATCCCTGTTCCATATTTACCAATTTCTGACATCAGCTCCCCTTCCCC
	TAGAAGGTAAAGAGGAATCAGCCAGCTTCCCTGCAGTCTATGATGGGGAGGACATGAAATGTGTGATAGAAGGTCCATGACTGGCACAGGTGCCCCTCCT
	ACCTGTAGGTTGGAAGTGATGGCTGCCAGGCCCTCTCCCTGCCAGGCAGCTAATAAGGGTAGGTTGTTCTCTCTGCCTAGAATTGATCCAGTGCTGCTGA
	AAGCCAGCAGCAGCAGCCCTAAAACTGGGCAGTGAAAATCCCTAGTGGGAGTTGACACATCCATATCACCATATATAACAATAACAAGCTGACTAGCAAG
	GTGTGGTTAAAGCACCTGTCTCAGGCCAAATGGGGGATTAAAAATGATGGCAGTTGGCTGGTCTCAACCCTTTTCCTCTCACTGACCCCCATAAATACTG
	ATTGGCCGACTCCCTTTGTCCCATTCACAAAGCAGGGAGTTATGAGATGCAGGCTGTGAGCTTAACCTGTGTGATTCCCAAGTGCCTTGGGCGAGCTGCC
	AGGAAGGTAATAGAAATACAAAATTTTACCCGACCCTTATCAGTTACCCTAGCAAGATCCCTAGGCAATTAAGTACTTTTGCTCTTAAATGTGTAGAAAC
	CTGGAGGCCAGCAGTCAAGAGCCAGGTAACTCCTCGATGGCTACTTTTGCATCTTGTTGCTCTCCCAGGTCCATACTGCAAGATTAAAGTGTTTTAAAAG
	GACTGCTTC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
23+3dbEST_BY716449.1,ENSMUST00000133836,GB_AK016771.1,
13+31dbEST_AA110931.1,dbEST_AA213360.1,dbEST_AA123319.1,dbEST_AI595070.1,REF_NM_023731.3,GB_AK036812.1,GB_AK078407.1,GB_AK078455.1,GB_AB041663.1,GB_BC043326.1,GB_AK088727.1,GB_DQ501252.1,
34+33dbEST_AA110931.1,dbEST_AA213360.1,dbEST_BB482641.2,dbEST_BE847873.1,REF_NM_023731.3,GB_AK036812.1,GB_AK078407.1,GB_AK078455.1,GB_AK016771.1,GB_AB041663.1,GB_BC043326.1,GB_AK088727.1,GB_DQ501252.1,
45+43dbEST_AA672190.1,dbEST_AA212206.1,dbEST_AA212207.1,dbEST_AA212208.1,REF_NM_023731.3,GB_AK036812.1,GB_AK078407.1,GB_AK078455.1,GB_AK016771.1,GB_AB041663.1,GB_BC043326.1,GB_AK088727.1,GB_DQ501252.1,