NIA Mouse Gene Index (mm92)

Exon structure for U038818

chr19 -

Exon1 11155593 - 11155474
	ATTCTAAATGAATCGCCCAACTGCACAGGGTGCAGTCAATCTCTCGGGGAGTAAGTTTTCTACAGCAAAGAGTTGGGAACCGGAGCAAGAGAGACTTACT
	TGGCAACCGGGCACAGTAAG
Exon2 11154093 - 11153874
	CATGAATACAGTAACTTCACCGGGCCCCATGGCCAATTCTGTATATGTGGTGGCACCGCCCAACAGTTATCCTGTGGTCCCAGGAACCGTGCCTCAGATG
	CCTATTTATCCCAGCAATCAGCCTCAAGTCCATGTGATTTCTGGTCATCTGCCTGGTTTGGTGCCAGCTATGACCGAACCGCCTGCCCAGAGAGTCTTGA
	AAAAGGGACAAGTCCTAGGG
Exon3 11150897 - 11150775
	GCCATCCAGATCCTGATCGGCCTGGTGCACATCGGCCTGGGCTCCATCATGATCACCAACCTCTTCAGCCACTATACACCTGTCTCCCTCTATGGAGGTT
	TCCCCTTCTGGGGAGGCATCTGG
Exon4 11146151 - 11146092
	TTTATCATTTCAGGATCTCTCTCAGTGGCGGCAGAAACTCAGCCCAATTCACCTTGCCTG
Exon5 11145338 - 11145201
	CTGAATGGCAGTGTGGGCTTGAACATCTTCAGCGCCATCTGTTCTGCGGTGGGCATCATGCTCTTCATCACAGACATCAGTATCTCATCAGGATACATCT
	ACCCTAGCTACTACCCTTACCAGGAGAACTTGGGTGTG
Exon6 11142978 - 11142865
	AGAACAGGCGTGGCTATTTCTAGTGTGCTACTCATCTTCTGCCTCTTGGAGCTCAGCATTGCAAGTGTGTCCTCCCACTTTGGCTGCCAAGTGGCCTGTT
	GTCACTACAACAAT
Exon7 11142267 - 11141961
	CCAGGTGTGGTCATTCCAAATGTCTATGCAGCAAACCCAGTGGTCATCCCAGAACCACCAAACCCAATACCAAGTTATTCCGAAGTAGTTCAAGACTCCA
	GATAAGTGAACCTGAAGATTCTAGAGACCAAGTGACATCCTCTCCTACCTAGACTCCTATAAACCAAGTTCTTCCTTTCCTGACGAAGGGTAAATATCTT
	TCTTGTGGCCTAAATTATAGACTCTTGCTTCAACTCACCCTGGAAAAATCTCTATTAAAACGAGATGGGAGATTGAAATGGATTCAAATAAAGATGCTCT
	AGCAGGA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+26dbEST_AA518262.1,dbEST_AI553283.1,dbEST_BF582669.1,dbEST_BF578225.1,REF_NM_022430.2,GB_AB026044.1,GB_AF237906.1,GB_AY039038.1,GB_BC042719.1,GB_AK008099.1,GB_BC153143.1,GB_BC148563.1,GB_AK172700.1,
23+25dbEST_AA833288.1,dbEST_AA518262.1,dbEST_AI553283.1,dbEST_BF582669.1,REF_NM_022430.2,GB_AB026044.1,GB_AF237906.1,GB_AY039038.1,GB_BC042719.1,GB_AK008099.1,GB_BC153143.1,GB_BC148563.1,GB_AK172700.1,
34+19dbEST_AA833288.1,dbEST_AA518262.1,dbEST_AI552228.1,dbEST_AI553283.1,REF_NM_022430.2,GB_AF237906.1,GB_AY039038.1,GB_BC042719.1,GB_AK008099.1,GB_BC153143.1,GB_BC148563.1,
45+22dbEST_AA469742.1,dbEST_AA833288.1,dbEST_AA518262.1,dbEST_AI552228.1,REF_NM_022430.2,GB_AB026044.1,GB_AF237906.1,GB_AY039038.1,GB_BC042719.1,GB_AK008099.1,GB_BC153143.1,GB_BC148563.1,
56+19dbEST_AA469742.1,dbEST_AA833288.1,dbEST_AA518262.1,dbEST_AI552228.1,REF_NM_022430.2,GB_AB026044.1,GB_AF237906.1,GB_AY039038.1,GB_BC042719.1,GB_AK008099.1,GB_BC153143.1,GB_BC148563.1,
67+15dbEST_AI481240.1,dbEST_AI152666.1,dbEST_AI552228.1,dbEST_BG968189.1,REF_NM_022430.2,GB_AB026044.1,GB_AF237906.1,GB_AY039038.1,GB_BC042719.1,GB_AK008099.1,GB_BC153143.1,GB_BC148563.1,